Affinity DataIC50: 2nMAssay Description:Inhibition of HIV integrase strand transfer activityMore data for this Ligand-Target Pair
Affinity DataIC50: 2.40nMAssay Description:Inhibition of His-tagged HIV-1 integrase-mediated 3' processing and strand transfer reactions using 5'-ACAGGCCTAGCACGCGTCG-Biotin-3' annealed with 5'...More data for this Ligand-Target Pair
Affinity DataIC50: 3.30nMAssay Description:Inhibition of Human immunodeficiency virus 1 integrase by strand transfer scintillation proximity assayMore data for this Ligand-Target Pair
Affinity DataIC50: 5nMAssay Description:Inhibition of HIV1 recombinant integrase 3'-processing and strand transfer activity using 21-mer U5B/U5A duplex oligonucleotides after 1 hrMore data for this Ligand-Target Pair
Affinity DataIC50: 6.80nMAssay Description:Inhibition of Human immunodeficiency virus 1 integrase strand transfer activityMore data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity preincubated for 30 mins followed by addition of FITC-labelled dsDNA for 1 hr by microplate re...More data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of HIV1 integrase strand transfer activityMore data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of strand transfer activity of HIV1 integrase using pre-cleaved oligonucleotide as substrate after 1 hr by ELISAMore data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of HIV1 integrase strand transfer activityMore data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of HIV1 integrase strand transferMore data for this Ligand-Target Pair
Affinity DataIC50: 9nMAssay Description:Inhibition of HIV1 integraseMore data for this Ligand-Target Pair
Affinity DataIC50: 9nMAssay Description:Inhibition of HIV1 integraseMore data for this Ligand-Target Pair
Affinity DataIC50: 9nMAssay Description:Inhibition of HIV1 integraseMore data for this Ligand-Target Pair
Affinity DataIC50: 9nMAssay Description:Inhibition of HIV-1 integrase after 1 hr by ELISAMore data for this Ligand-Target Pair
Affinity DataIC50: 9nMAssay Description:Inhibition of Human immunodeficiency virus 1 integraseMore data for this Ligand-Target Pair
Affinity DataIC50: 10nMAssay Description:Inhibition of HIV-1 overall integrase activity using 5'-digoxigenin-labeled GACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT-3' as substrate after 1 hr by ELISAMore data for this Ligand-Target Pair
Affinity DataIC50: 10nMAssay Description:Inhibition of HIV1 integrase overall inhibition using 5'-digoxigenin-labeled 5'-GACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT-3' as substrate after 1 hr by ELI...More data for this Ligand-Target Pair
Affinity DataIC50: 13nMAssay Description:Inhibition of recombinant HIV-1 integrase stand transfer activity expressed in Escherichia coli BL21(DE3) cells using 32P-labeled DNA substrate after...More data for this Ligand-Target Pair
TargetGag-Pol polyprotein(Human immunodeficiency virus type 1 group M subtyp...)
Merck Research Laboratories
Merck Research Laboratories
Affinity DataIC50: 15nMpH: 7.8 T: 2°CAssay Description:The microtiter plate assay for stand transfer was performed with an immobilized donor substrate and a target substrate biotinylated at the 3-prime en...More data for this Ligand-Target Pair
Affinity DataIC50: 15nMAssay Description:Inhibition of recombinant HIV-1 integrase strand transfer activityMore data for this Ligand-Target Pair
Affinity DataIC50: 15nMAssay Description:Inhibition of recombinant HIV-1 integrase strand transfer activity by enzymatic assayMore data for this Ligand-Target Pair
Affinity DataIC50: 16nMAssay Description:Displacement of 20 nM [3H]GSK304649 from Human immunodeficiency virus 1 integrase by scintillation proximity assayMore data for this Ligand-Target Pair
Affinity DataIC50: 19nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: 27nMAssay Description:Inhibition of wild type recombinant HIV1 His6-tagged integrase expressed in Escherichia coli BL21 using 18 nucleotide 3'-biotin labeled DNA acceptor ...More data for this Ligand-Target Pair
Affinity DataIC50: 34nMAssay Description:Inhibition of HIV1 integrase strand transfer activityMore data for this Ligand-Target Pair
Affinity DataIC50: 50nMAssay Description:Inhibition of HIV-1 integrase G140S mutant strand transfer activity preincubated for 30 mins followed by addition of FITC-labelled dsDNA for 1 hr by ...More data for this Ligand-Target Pair
Affinity DataIC50: 53nMAssay Description:Inhibition of His-tagged HIV-1 integrase-mediated 3' processing and strand transfer reactions using 5'-ACAGGCCTAGCACGCGTCG-Biotin-3' annealed with 5'...More data for this Ligand-Target Pair
Affinity DataIC50: 58nMAssay Description:Inhibition of LEDGF/p75-dependent full length HIV-1 integrase expressed in Escherichia coli BL21(DE3) cells preincubated for 1 hr further incubated f...More data for this Ligand-Target Pair
Affinity DataIC50: 67nMAssay Description:Inhibition of HIV1 integrase 3'-processing activity using labelled oligonucleotide substrate by ELISAMore data for this Ligand-Target Pair
Affinity DataIC50: 67nMAssay Description:Inhibition of HIV1 recombinant integrase strand transfer activity expressed in Escherichia coli after 60 mins using [32P]-labeled oligonucleotide as ...More data for this Ligand-Target Pair
Affinity DataIC50: 67nMAssay Description:Inhibition of HIV1 recombinant integrase strand transfer activity expressed in Escherichia coli after 30 mins using [32P]-labeled oligonucleotide as ...More data for this Ligand-Target Pair
Affinity DataIC50: 71nMAssay Description:Inhibition of strand transfer activity of HIV1 integrase expressed in Escherichia coli using DNA complexes containing 32P-labeled INT1ST and and non-...More data for this Ligand-Target Pair
Affinity DataIC50: 74nMAssay Description:Inhibition of HIV1 recombinant integrase strand transfer activity expressed in Escherichia coli after 60 mins using [32P]-labeled oligonucleotide as ...More data for this Ligand-Target Pair
Affinity DataIC50: 80nMAssay Description:Inhibition of HIV1 integrase using labelled oligonucleotide substrate by ELISAMore data for this Ligand-Target Pair
Affinity DataIC50: 87nMAssay Description:Inhibition of HIV1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 87nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 120nMAssay Description:Inhibition of HIV1 integraseMore data for this Ligand-Target Pair
Affinity DataIC50: 200nMAssay Description:Inhibition of recombinant HIV1 integrase strand transfer activity using biotin-labeled double-stranded HIV-1 LTR U5 donor DNA substrate pretreated fo...More data for this Ligand-Target Pair
Affinity DataIC50: 650nMAssay Description:Inhibition of HIV1 integrase strand transfer activity using 5'-biotinylated oligonucleotide as substrate preincubated for 10 mins followed by substra...More data for this Ligand-Target Pair
Affinity DataIC50: 650nMAssay Description:Inhibition of HIV1 recombinant integrase expressed in Escherichia coli using [32P]-labeled oligonucleotide as substrate after 60 mins by strand trans...More data for this Ligand-Target Pair
Affinity DataIC50: 650nMAssay Description:Inhibition of HIV1 integrase pre-incubated for 10 mins before DNA substrate addition and measured after 30 minsMore data for this Ligand-Target Pair
Affinity DataIC50: 650nMAssay Description:Inhibition of HIV integrase strand transfer activity using 5'-biotin/3'-Cy5-labeled DNA substrate preincubated for 5 mins followed by substrate addit...More data for this Ligand-Target Pair
Affinity DataIC50: 900nMAssay Description:Inhibition of Human immunodeficiency virus 1 integrase-mediated strand transfer activity after 1 hrMore data for this Ligand-Target Pair
Affinity DataIC50: 900nMAssay Description:Inhibition of 3'-processing activity of HIV1 integrase using 32P-5'-TGTGGAAAATCTCTAGCAGT-3' and 5'-ACTGCTAGAGATTTTCCACA-3' as substrate after 1 hr by...More data for this Ligand-Target Pair
Affinity DataIC50: 900nMAssay Description:Inhibition of HIV1 integrase 3'-end processing activityMore data for this Ligand-Target Pair
Affinity DataIC50: 1.10E+3nMAssay Description:Inhibition of recombinant HIV1 integrase strand transfer activity using biotin-labeled double-stranded HIV1 LTR U5 donor DNA substrate pretreated for...More data for this Ligand-Target Pair
Affinity DataIC50: 1.80E+3nMAssay Description:Inhibition of HIV-1 integrase after 1 hr by strand transfer activity assayMore data for this Ligand-Target Pair
Affinity DataIC50: >4.50E+3nMAssay Description:Inhibition of HIV1 recombinant integrase 3'-processing activity expressed in Escherichia coli after 60 mins using [32P]-labeled oligonucleotide as a ...More data for this Ligand-Target Pair