FUMARIC ACID Fumarate (2E)-but-2-enedioic acid BDBM26122 fumarate, 10
HC-20511 fumarate CHEMBL1633 Zaditor Alaway Ketotifen KETOTIFEN FUMARATE BDBM50258516
BDBM50342427 CHEMBL1771637 ethyl fumarate
Butyl fumarate BDBM50342423 CHEMBL1771640
CHEMBL1771638 Propyl fumarate BDBM50342425
CHEMBL1771639 BDBM50342424 Isopropyl fumarate
CHEMBL1771641 Pentyl fumarate BDBM50342422
CHEMBL1771737 Benzyl fumarate BDBM50342420
CHEMBL1771739 BDBM50342418 Phenylethyl fumarate
Hexyl fumarate CHEMBL1771642 BDBM50342421
3-Bromobenzyl fumarate BDBM50342417 CHEMBL1771743
CHEMBL1771744 BDBM50342416 3-Chlorobenzyl fumarate
CHEMBL1771745 BDBM50342415 3-Fluorobenzyl fumarate
CAS_21906 CHEMBL664 Cotinine fumarate BDBM82069 NSC_21906
CHEMBL1771738 (rac)-alpha-methylbenzyl fumarate BDBM50342419
MLS001333570 cid_9938794 Tiamulin fumarate SMR000875281 BDBM94567
TEKTURNA ALISKIREN FUMARATE Aliskiren hemifumarate BDBM50392952
(1-Ammonium-3-methyl-butyl)-phosphonic acid monomethyl ester BDBM50024606 CHEMBL40534
BDBM50024599 CHEMBL296889 (1-Ammonium-2-phenyl-ethyl)-phosphonic acid monomethyl ester
BDBM50090502 (1R,4S)-7-Oxa-bicyclo[2.2.1]heptane-2,3-dicarboxylic acid monomethyl ester CHEMBL47665 (1S,4R)-7-Oxa-bicyclo[2.2.1]heptane-2,3-dicarboxylic acid monomethyl ester
CHEBI:59273 Disomer Dexbrompheniramine Maleate Dexbrompheniramine fumarate BDBM50247924
Fesoterodine Fumarate BDBM50248002 SPM-907 Toviaz SPM-8272
MLS002320713 SMR001338859 BDBM83463 (-)-Metazocine fumarate (2:1) cid_45479833
BDBM50110695 CHEMBL278014 7-Oxa-bicyclo[2.2.1]heptane-2,3-dicarboxylic acid monomethyl ester
BDBM50419318 YM-08316 BD-40A CGP-25827A FORMOTEROL FUMARATE
(2S)-2-amino-5-[(N-methylcarbamimidoyl)amino]pentanoic acid NG-monomethyl-L-arginine acetate (2S)-2-ammonio-5-{[iminio(methylamino)methyl]amino}pentanoate N(G)-mono-methyl-L-arginine (R)-2-Amino-5-(N'-methyl-guanidino)-pentanoic acid Ngamma-monomethyl-L-arginine (S)-2-amino-5-(2-methylguanidino)pentanoic acid N(G)-monomethyl-L-arginine N-gamma-monomethyl-L-arginine Targinine (S)-2-Amino-5-(N'-methyl-guanidino)-pentanoic acid CHEMBL256147 N-Monomethyl-L-arginine L-NMMA N omega-methyl-L-arginine NG-Monomethyl-L-Arginine (S)-2-amino-5-(3-methylguanidino)pentanoic acid 2-Amino-5-(N'-methyl-guanidino)-pentanoic acid BDBM50230993
2,2-Bis-[4-(difluoro-phosphono-methyl)-benzyl]-malonic acid monomethyl ester CHEMBL9070 BDBM50142308
BDBM50306816 CHEMBL605993 formoterol fumarate N-(2-hydroxy-5-((R)-1-hydroxy-2-((R)-1-(4-methoxyphenyl)propan-2-ylamino)ethyl)phenyl)formamide fumarate
BDBM50148444 2-{4-[2-(Naphthalen-2-yloxy)-ethoxy]-benzyl}-malonic acid monomethyl ester CHEMBL331388
(R)-2-(3-amino-1-phenylpropoxy)-5-chlorobenzonitrile fumarate BDBM50340006 CHEMBL1762477
(R)-2-(3-amino-1-phenylpropylthio)-4-chlorobenzonitrile fumarate BDBM50339998 CHEMBL1762474
(R)-2-(3-amino-1-phenylpropylthio)-6-methylnicotinonitrile fumarate CHEMBL1762480 BDBM50340003
methyl fumarate BDBM50342426 CHEMBL589586 4-methoxy-4-oxobut-2-enoic acid
1-Phenyl-3-(2-piperidin-4-yl-ethyl)-1H-indole; fumarate BDBM50029142
3-(2-Piperidin-4-yl-ethyl)-1H-indol-5-ol; fumarate BDBM50029145
5-Chloro-3-piperidin-4-ylmethyl-1H-indole; 5 moles of fumarate BDBM50029144
BDBM50029146 3-(2-Piperidin-4-yl-ethyl)-1H-indol-6-ol; fumarate
(4-(6-(allyl(methyl)amino)hexyloxy)-2-fluorophenyl)(4-bromophenyl)methanone fumarate BDBM50130770 CHEMBL324162 {4-[6-(Allyl-methyl-amino)-hexyloxy]-2-fluoro-phenyl}-(4-bromo-phenyl)-methanone; fumarate
2-{4-[2-(1,2,3,4-Tetrahydro-quinolin-7-yloxy)-ethoxy]-benzyl}-malonic acid monomethyl ester CHEMBL118577 BDBM50148443
BDBM50066987 CHEMBL127408 [(R)-2-(2-Benzyloxycarbonylamino-4-methyl-pentanoylamino)-4-methyl-pentanoyl]-phosphonic acid monomethyl ester
CHEMBL119795 BDBM50148442 2-{4-[2-(5,6,7,8-Tetrahydro-naphthalen-2-yloxy)-ethoxy]-benzyl}-malonic acid monomethyl ester
BDBM50036776 CHEMBL122165 6,8-difluoro-1'-phenethylspiro[1,2,3,4-tetrahydronaphthalene-2,4'-(hexahydropyridine)]-1-one; fumarate
BDBM86906 methyl-[1-(2-pyridin-3-yl-vinyl)-cyclopropyl]-amine fumarate CAS_9922040 NSC_9922040
CHEMBL1762471 (R)-3-(2,5-dichlorophenoxy)-N-methyl-3-phenylpropan-1-amine fumarate BDBM50339995
NSC_44454204 BDBM86917 CAS_44454204 methyl-{1-[3-(pyridin-3-yloxy)-propyl]-cyclopropyl}-amine fumarate
NSC_9944441 CAS_9944441 methyl-{1-[2-(pyridin-3-yloxy)-ethyl]-cyclopropyl}-amine fumarate BDBM86920
SER-082 BDBM85099 CAS_141474-54-6 SDZ SER 082 FUMARATE SDZ SER-082
BDBM50055303 [3-(1-Benzyl-3-carbamoylmethyl-2-ethyl-1H-indol-5-yloxy)-propyl]-phosphonic acid monomethyl ester CHEMBL150154
CHEMBL116920 BDBM50148452 2-{4-[2-(5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yloxy)-ethoxy]-benzyl}-malonic acid monomethyl ester
BDBM50130782 CHEMBL114259 {4-[6-(Allyl-methyl-amino)-hexyloxy]-phenyl}-(4-bromo-phenyl)-methanone; fumarate
BDBM50278878 CHEMBL502567 cis-3-(5-Isopropyloxy-3-pyridinyl)-3,7-diazabicyclo[3.3.0]octane Semi(fumarate)
Allyl-{6-[4-(6-bromo-benzo[d]isothiazol-3-yl)-phenoxy]-hexyl}-methyl-amine; fumarate N-allyl-6-(4-(6-bromobenzo[d]isothiazol-3-yl)phenoxy)-N-methylhexan-1-amine fumarate CHEMBL112553 BDBM50240748
BDBM50130780 CHEMBL112210 N-allyl-6-(3-(4-bromophenyl)benzo[d]isothiazol-6-yloxy)-N-methylhexan-1-amine fumarate Allyl-{6-[3-(4-bromo-phenyl)-benzo[d]isothiazol-6-yloxy]-hexyl}-methyl-amine; fumarate
BDBM50416760 FUMARIC ACID Fumaric Acid 2-butenedioic acid, (e)- E-297 INS NO.297 E297 Fumaricum acidum Fumarate Fumaric acid Allomaleic-acid FEMA NO. 2488 INS-297 NSC-2752 CHEBI:18012 Boletic-acid Monosodium fumarate
FUMARIC ACID BDBM50620915 Fumaric Acid 2-butenedioic acid, (e)- E-297 INS NO.297 E297 Fumaricum acidum Fumarate Fumaric acid Allomaleic-acid FEMA NO. 2488 INS-297 NSC-2752 CHEBI:18012 Boletic-acid Monosodium fumarate
3-{2-[bis-(4-fluorophenyl)methoxy]ethyl}-6-cinnamyl-3,6-diazabicyclo[3.1.1]heptane fumarate BDBM50209491
BDBM50130771 CHEMBL114747 CHEMBL611756 (4-Bromo-phenyl)-{4-[6-(cyclopropylmethyl-methyl-amino)-hexyloxy]-phenyl}-methanone; fumarate
N-allyl-6-(3-(4-bromophenyl)-1-methyl-1H-indazol-6-yloxy)-N-methylhexan-1-amine fumarate BDBM50130790 CHEMBL115497 Allyl-{6-[3-(4-bromo-phenyl)-1-methyl-1H-indazol-6-yloxy]-hexyl}-methyl-amine; fumarate
5-phenyl-3-[(4-pyrrolidin-1-ylbut-2-yn-1-yl)oxy]-isoxazole fumarate BDBM50223166 CHEMBL428916
BDBM50223186 5-methyl-3-[(4-pyrrolidin-1-ylbut-2-yn-1-yl)oxy]-isoxazole fumarate CHEMBL397083
CHEMBL239017 BDBM50223173 N,N-dimethyl-4-[(5-methylisoxazol-3-yl)oxy]-but-2-yn-1-amine fumarate
CHEMBL419402 Allyl-{6-[4-(4-bromo-phenyl)-quinazolin-7-yloxy]-hexyl}-methyl-amine; fumarate BDBM50130781 CHEMBL612026
BDBM50087306 CHEMBL36692 [6-(8-Hydroxy-7,8-dihydro-6H-imidazo[4,5-d][1,3]diazepin-3-yl)-hexyl]-phosphonic acid monomethyl ester 2H2O
BDBM50130774 CHEMBL115375 {4-[6-(Allyl-methyl-amino)-hexyloxy]-2-hydroxy-phenyl}-(4-bromo-phenyl)-methanone; fumarate CHEMBL611757
BDBM50130783 CHEMBL115020 CHEMBL611485 {4-[6-(Allyl-methyl-amino)-hexyloxy]-2-methoxy-phenyl}-(4-bromo-phenyl)-methanone; fumarate
BDBM50130786 CHEMBL611486 {4-[6-(Allyl-methyl-amino)-hexyloxy]-2-methylsulfanyl-phenyl}-(4-bromo-phenyl)-methanone; fumarate CHEMBL115923
BDBM50255430 N-(4-(5-(ethyl(2-hydroxyethyl)amino)pentyl)cyclohexyl)-N-methyl-4-(trifluoromethyl)benzenesulfonamide fumarate CHEMBL473035
CHEMBL114266 {6-[6-(Allyl-methyl-amino)-hexyloxy]-pyridin-3-yl}-(4-bromo-phenyl)-methanone; fumarate CHEMBL612025 BDBM50130787
CHEMBL116000 Allyl-{6-[3-(4-bromo-phenyl)-benzo[b]thiophen-6-yloxy]-hexyl}-methyl-amine; fumarate BDBM50130789
CHEMBL525720 cis-2-(5-Phenylpyridin-3-yl)-5-methyl-octahydro-pyrrolo[3,4-c]-pyrrole Sesqui-fumarate BDBM50278906
CHEMBL611484 CHEMBL116705 BDBM50130788 {4-[6-(Allyl-methyl-amino)-hexyloxy]-2-methylamino-phenyl}-(4-bromo-phenyl)-methanone; fumarate
CHEMBL611487 (4-Bromo-phenyl)-(4-{6-[(3-hydroxy-propyl)-methyl-amino]-hexyloxy}-phenyl)-methanone; fumarate CHEMBL114910 BDBM50130777
BDBM50012747 {3-[2-(2-tert-Butoxycarbonylamino-3-phenyl-propionylamino)-4-methyl-pentanoylamino]-4-cyclohexyl-2-hydroxy-butyl}-phosphonic acid monomethyl ester CHEMBL3143416
(S)-1,2,9,10-tetramethoxy-6-methyl-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinoline GLAUCINE glaucine fumarate BDBM50197829 CHEMBL228082
6-[(benzofuran-2-yl)methyl]-3-{2-[bis-(4-fluorophenyl)methoxy]ethyl}-3,6-diazabicyclo [3.1.1]heptane fumarate BDBM50209494
BDBM50209495 3-{2-[bis-(4-fluorophenyl)methoxy]ethyl}-6-[(1Hinden-2-yl)methyl]-3,6-diazabicyclo [3.1.1]heptane fumarate
BDBM50510130 FEMA NO. 2488 Fumaric Acid INS-297 NSC-2752 CHEBI:18012 E-297 INS NO.297 E297 Monosodium fumarate
CHEMBL481811 BDBM50255386 N-allyl-4-(3-(4-bromophenyl)benzofuran-6-yloxy)-N-methylbut-2-en-1-amine fumarate
CHEMBL502840 BDBM50278879 cis-4-(5-(Hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl)pyridin-3-yl)morpholine Sesqui-fumarate
3-{2-[bis-(4-fluorophenyl)methoxy]ethyl}-6-[(E)-3-furan-2-ylallyl]-3,6-diazabicyclo [3.1.1]heptane fumarate BDBM50209497
BDBM50130773 Allyl-{6-[4-(4-bromo-phenyl)-1H-benzo[d][1,2]oxazin-7-yloxy]-hexyl}-methyl-amine; fumarate CHEMBL115085
BDBM50209490 3-{2-[bis-(4-fluorophenyl)methoxy]ethyl}-6-[(E)-3-thiophen-2-ylallyl]-3,6-diazabicyclo[3.1.1]heptane fumarate
BDBM50209492 3-{2-[bis-(4-fluorophenyl)methoxy]ethyl}-6-[(E)-3-(naphthalen-2-yl)allyl]-3,6-diazabicyclo[3.1.1]heptane fumarate
BDBM50209493 3-{2-[bis-(4-fluorophenyl)methoxy]ethyl}-6-[3-(2-methylphenyl)prop-2-enyl]-3,6-diazabicyclo[3.1.1]heptane fumarate
6-[(benzo[b]thiophen-2-yl)methyl]-3-{2-[bis-(4-fluorophenyl)methoxy]ethyl}-3,6-diaza bicyclo[3.1.1]heptane fumarate BDBM50209496
BDBM338731 N-(5-methyl-1,3,4- thiadiazol-2-yl)-3- (trans-2-(tetrahydro-2H- pyran-4-ylamino)- cyclopropyl)benzamide fumarate US9751885, 165
Concor Bisoprolol fumarate [2-hydroxy-3-(4-{[2-(propan-2-yloxy)ethoxy]methyl}phenoxy)propyl](propan-2-yl)amine Bisoprolol BDBM25751
((1S,2S)-3-Cyclohexyl-2-{(S)-2-[(S)-2-(cyclopentanecarbonyl-amino)-3-phenyl-propionylamino]-4-methyl-pentanoylamino}-1-hydroxy-propyl)-phosphonic acid monomethyl ester BDBM50029587 CHEMBL342596
BDBM338742 3-(trans-2-((1-cyclo- propylpiperidin-4- yl)amino)cyclopropyl)- N-(5-methyl-1,3,4- thiadiazol-2-yl) benzamide fumarate US9751885, 176
BDBM50130772 Allyl-{6-[3-(4-bromo-phenyl)-1,1-dioxo-1H-1lambda*6*-benzo[d]isothiazol-6-yloxy]-hexyl}-methyl-amine; fumarate CHEMBL324034
BDBM50167874 3-Chloro-4-[4-(3-pyrimidin-2-yl-piperidin-1-yl)-butyl]-4H-benzo[f][1,4]oxazepin-5-one; Compound with fumarate
3-(trans-2- (cyclobutylamino)- cyclopropyl)-N-(5- methyl-1,3,4-thiadiazol- 2-yl)benzamide 1/2 fumarate (optical isomer, retention timelong) BDBM338816 US9751885, 253
BDBM14382 4-{2-[6-Amino-3-(3-cyclopentyloxy-4-methoxy-benzyl)-3H-purin-8-yl]-2-methyl-propoxy}-benzamide Fumarate V11294 Analogue 5r
US9751885, 224 4-fluoro-N-(5-methyl- 1,3,4-thiadiazol-2-yl)-3- (trans-2-(tetrahydro-2H- pyran-4- ylamino)cyclopropyl)- benzamide fumarate BDBM338789
US9751885, 254 BDBM338817 3-(trans-2- (cyclobutylamino)- cyclopropyl)-N-(5- methyl-1,3,4-thiadiazol- 2-yl)benzamide 1/2 fumarate (optical isomer, retention timeshort)
(4-(3,4-difluorophenyl)piperazin-1-yl)((4S,4aS,8aR)-2-((S)-3-(6-methoxypyridin-3-yl)-2-methylpropyl)decahydroisoquinolin-4-yl)methanone fumarate BDBM50312945 CHEMBL1076624
3-(trans-2- ((cyclopropylmethyl)- amino)cyclopropyl)-N-(1- (2,2,2- trifluoroethyl)piperidin- 4-yl)benzamide 3/2 fumarate (optical isomer, retention time long) BDBM338834 US9751885, 271
3-Chloro-4-[4-(5-pyrimidin-2-yl-3,6-dihydro-2H-pyridin-1-yl)-butyl]-4H-benzo[f][1,4]oxazepin-5-one; Compound with fumarate BDBM50167870
BDBM50119076 (1R,6S,8S,8aS)-6-Amino-1-ethyl-8-methoxy-6-(2-methyl-allyl)-5-oxo-octahydro-indolizine-3-carboxylic acid 4-carbamimidoyl-benzylamide fumarate
BDBM50167871 3-Chloro-4-{4-[5-(4-methyl-pyrimidin-2-yl)-3,4-dihydro-2H-pyridin-1-yl]-butyl}-4H-benzo[f][1,4]oxazepin-5-one; Compound with fumarate
Cotellic XL518 COBIMETINIB FUMARATE (3,4-difluoro-2-(2-fluoro-4-iodophenylamino)phenyl)(3-hydroxy-3-(piperidin-2-yl)azetidin-1-yl)methanone BDBM50391802 GDC-0973 cobimetinib CHEMBL2146883
BDBM94624 3-benzoyloxy-8-methyl-8-azabicyclo[3.2.1]octane-4-carboxylic acid ethyl ester;(E)-2-butenedioate MLS002320699 (E)-but-2-enedioate;ethyl 8-methyl-3-(phenylcarbonyloxy)-8-azabicyclo[3.2.1]octane-4-carboxylate cid_45479832 (E)-but-2-enedioate;ethyl 3-benzoyloxy-8-methyl-8-azabicyclo[3.2.1]octane-4-carboxylate 3-benzoyloxy-8-methyl-8-azabicyclo[3.2.1]octane-4-carboxylic acid ethyl ester;fumarate SMR001338845 (-)-Cocaethylene fumarate
(E)-2-butenedioate;(2R)-2-[2-[(1R)-1-(4-chlorophenyl)-1-phenylethoxy]ethyl]-1-methylpyrrolidine MLS002154260 BDBM94606 (2R)-2-[2-[(1R)-1-(4-chlorophenyl)-1-phenyl-ethoxy]ethyl]-1-methyl-pyrrolidine;fumarate Clemastine fumarate SMR001233520 (E)-but-2-enedioate;(2R)-2-[2-[(1R)-1-(4-chlorophenyl)-1-phenylethoxy]ethyl]-1-methylpyrrolidine (E)-but-2-enedioate;(2R)-2-[2-[(1R)-1-(4-chlorophenyl)-1-phenyl-ethoxy]ethyl]-1-methyl-pyrrolidine cid_45479735
Aliskiren Hemifumarate BDBM17950 Rasilez Aliskiren TEKTURNA (2S,4S,5S,7S)-5-amino-N-(2-carbamoyl-2,2-dimethylethyl)-4-hydroxy-7-{[4-methoxy-3-(3-methoxypropoxy)phenyl]methyl}-8-methyl-2-(propan-2-yl)nonanamide ALISKIREN FUMARATE CHEMBL1639
(2S)-5-{[(Z)-amino(imino)methyl]amino}-2-(methylamino)pentanoic acid BDBM50134378 (S)-5-Guanidino-2-methylamino-pentanoic acid N~5~-(DIAMINOMETHYLENE)-N~2~-METHYLORNITHINE N-Monomethyl-L-arginine (2S)-5-{[amino(imino)methyl]amino}-2-(methylamino)pentanoic acid (S)-5-guanidino-2-(methylamino)pentanoic acid CHEMBL332148
N-[2-(1-benzylpiperidin-4-yl)ethyl]-N-phenylbenzamide Fumarate CHEMBL544629 CHEMBL55312 N-[2-(1-Benzyl-piperidin-4-yl)-ethyl]-N-phenyl-benzamide (C4H4O4) (2E)-but-2-enedioic acid; N-[2-(1-benzylpiperidin-4-yl)ethyl]-N-phenylbenzamide BDBM9408 Piperidine Derivative 20
(2E)-but-2-enedioic acid; 3-{[3-(cyclopentyloxy)-4-methoxyphenyl]methyl}-8-{2-[(3,4-difluorophenyl)methoxy]propan-2-yl}-3H-purin-6-amine 3-(3-Cyclopentyloxy-4-methoxy-benzyl)-8-[1-(3,4-difluoro-benzyloxy)-1-methyl-ethyl]-3Hpurin-6-ylamine Fumarate BDBM14375 V11294 Analogue 5k
(2E)-but-2-enedioic acid; 3-{[3-(cyclopentyloxy)-4-methoxyphenyl]methyl}-8-{2-[(3,5-dimethoxyphenyl)methoxy]propan-2-yl}-3H-purin-6-amine 3-(3-Cyclopentyloxy-4-methoxy-benzyl)-8-[1-(3,5-dimethoxy-benzyloxy)-1-methyl-ethyl]-3Hpurin-6-ylamine Fumarate V11294 Analogue 5j BDBM14374
3-(3-Cyclopentyloxy-4-methoxy-benzyl)-8-[1-(3,4-dimethoxy-benzyloxy)-1-methyl-ethyl]-3Hpurin-6-ylamine Fumarate BDBM14373 V11294 Analogue 5i (2E)-but-2-enedioic acid; 3-{[3-(cyclopentyloxy)-4-methoxyphenyl]methyl}-8-{2-[(3,4-dimethoxyphenyl)methoxy]propan-2-yl}-3H-purin-6-amine
AZL O 211089 CHEBI:76004 FP-187 BDBM50504654 AZL 0 211089 BG-00012 Dimethyl fumar Fumaric acid dimethyl ester NSC-25942 BG 00012 BG-12 LAS-41008 FAG-201 BG00012 Dimethyl fumarate NSC-167432 FP187 AZL-0211089 Las41008 Tecfidera BG 12 AZL-O-211089
FORMOTEROL cid_9912089 CHEMBL605993 N-(2-hydroxy-5-((R)-1-hydroxy-2-((R)-1-(4-methoxyphenyl)propan-2-ylamino)ethyl)phenyl)formamide ARFORMOTEROL TARTRATE CHEMBL1363 BDBM50151720 FORMOTEROL FUMARATE Symbicort Foradil N-(2-Hydroxy-5-{1-hydroxy-2-[2-(4-methoxy-phenyl)-1-methyl-ethylamino]-ethyl}-phenyl)-formamide
(-)-Eseroline fumarate salt MLS002153374 (3aR,8bS)-3,4,8b-trimethyl-2,3a-dihydro-1H-pyrrolo[2,3-b]indol-7-ol;(Z)-2-butenedioate BDBM93695 cid_45479742 (3aR,8bS)-3,4,8b-trimethyl-2,3a-dihydro-1H-pyrrol[2,3-b]indol-7-ol;maleate (3aR,8bS)-3,4,8b-trimethyl-2,3a-dihydro-1H-pyrrolo[2,3-b]indol-7-ol;(Z)-but-2-enedioate SMR001230765
cid_5282408 10-(1-methyl-4-piperidylidene)-5H-benzo[1,2]cyclohepta[3,4-b]thiophen-4-one;maleate (Z)-2-butenedioate;10-(1-methyl-4-piperidinylidene)-5H-benzo[1,2]cyclohepta[3,4-b]thiophen-4-one Ketotifen Ketotifen fumarate (Z)-but-2-enedioate;10-(1-methylpiperidin-4-ylidene)-5H-benzo[1,2]cyclohepta[3,4-b]thiophen-4-one BDBM94597 cid_45479747 US9333199, KETOTIFEN MLS002222254 SMR001307257 US9138431, KETOTIFEN
(E)-but-2-enedioic acid;N-[2-hydroxy-5-[(1R)-1-hydroxy-2-[[(1S)-1-(4-methoxyphenyl)ethyl]amino]ethyl]phenyl]formamide (E)-but-2-enedioic acid;N-[5-[(1R)-2-[[(1S)-1-(4-methoxyphenyl)ethyl]amino]-1-oxidanyl-ethyl]-2-oxidanyl-phenyl]methanamide SMR000058964 (E)-2-butenedioic acid;N-[2-hydroxy-5-[(1R)-1-hydroxy-2-[[(1S)-1-(4-methoxyphenyl)ethyl]amino]ethyl]phenyl]formamide fumaric acid;N-[2-hydroxy-5-[(1R)-1-hydroxy-2-[[(1S)-1-(4-methoxyphenyl)ethyl]amino]ethyl]phenyl]formamide FORMOTEROL FUMARATE cid_6852396 BDBM84214 MLS000028758
- Hamann, LG; Farmer, LJ; Johnson, MG; Bender, SL; Mais, DE; Wang, MW; Crombie, D; Goldman, ME; Jones, TK Synthesis and biological activity of novel nonsteroidal progesterone receptor antagonists based on cyclocymopol monomethyl ether. J Med Chem 39: 1778-89 (1996)
- Machulkin, AE; Uspenskaya, AA; Zyk, NU; Nimenko, EA; Ber, AP; Petrov, SA; Polshakov, VI; Shafikov, RR; Skvortsov, DA; Plotnikova, EA; Pankratov, AA; Smirnova, GB; Borisova, YA; Pokrovsky, VS; Kolmogorov, VS; Vaneev, AN; Khudyakov, AD; Chepikova, OE; Kovalev, S; Zamyatnin, AA; Erofeev, A; Gorelkin, P; Beloglazkina, EK; Zyk, NV; Khazanova, ES; Majouga, AG Synthesis, Characterization, and Preclinical Evaluation of a Small-Molecule Prostate-Specific Membrane Antigen-Targeted Monomethyl Auristatin E Conjugate. J Med Chem 64: 17123-17145 (2021)
- Tong, L; Phan, TK; Robinson, KL; Babusis, D; Strab, R; Bhoopathy, S; Hidalgo, IJ; Rhodes, GR; Ray, AS Effects of human immunodeficiency virus protease inhibitors on the intestinal absorption of tenofovir disoproxil fumarate in vitro. Antimicrob Agents Chemother 51: 3498-504 (2007)
- Liu, WC; Wang, YY; Liu, JH; Ke, AB; Zheng, ZH; Lu, XH; Luan, YS; Xiu, ZL; Dong, YS Wortmannilactones I-L, new NADH-fumarate reductase inhibitors, induced by adding suberoylanilide hydroxamic acid to the culture medium of Talaromyces wortmannii. Bioorg Med Chem Lett 26: 5328-5333 (2016)
- Guo, J; Cheng, M; Liu, P; Cao, D; Luo, J; Wan, Y; Fang, Y; Jin, Y; Xie, SS; Liu, J A multi-target directed ligands strategy for the treatment of Alzheimer's disease: Dimethyl fumarate plus Tranilast modified Dithiocarbate as AChE inhibitor and Nrf2 activator. Eur J Med Chem 242: (2022)
- Xu, SQ; Yan, X; Chen, Y; Xia, P; Qian, K; Yu, D; Xia, Y; Yang, ZY; Morris-Natschke, SL; Lee, KH Anti-AIDS agents 84. Synthesis and anti-human immunodeficiency virus (HIV) activity of 2'-monomethyl-4-methyl- and 1'-thia-4-methyl-(3'R,4'R)-3',4'-di-O-(S)-camphanoyl-(+)-cis-khellactone (DCK) analogs. Bioorg Med Chem 18: 7203-11 (2010)
- ChEMBL_2173309 (CHEMBL5058443) Inhibition of G9a (unknown origin) using biotinylated histone monomethyl-H3K9 peptide by TR-FRET assay
- ChEMBL_2173324 (CHEMBL5058458) Inhibition of DNMT1 (unknown origin) using biotinylated histone monomethyl-H3K9 peptide by TR-FRET assay
- ChEMBL_1620907 (CHEMBL3863190) Inhibition of NADH-Fumarate reductase in Ascaris suum muscle sub-mitochondrial particles using disodium fumarate as substrate in presence of NADH after 3 mins measured every 15 sec for 10 mins under anaerobic condition
- ChEBML_59140 Binding affinity towards Dopamine beta hydroxylase using tyramine substrate at pH 4.5 in the absence of fumarate
- ChEMBL_2125715 (CHEMBL4835060) Inhibition of human G9a enzyme using histone monomethyl-H3K9 peptide as substrate incubated for 1 hr in presence of SAM by TR-FRET assay
- ChEMBL_2048576 (CHEMBL4703275) Inhibition of SMYD2 (unknown origin) transfected in human U2OS cells assessed as inhibition of methylation of monomethyl p53 peptide incubated for 24 hrs by immunofluorescence assay
- ChEMBL_1504126 (CHEMBL3591658) Inhibition of PRMT1 in human A375 cells assessed as effect on monomethyl R*GG motif methylation at 0.01 to 20 uM incubated for 48 hrs by Western blot method
- G9a Enzyme Activity Assay The biochemical assay to measure G9a enzyme activity relies on time-resolved fluorescence energy transfer (TR-FRET) between europium cryptate (donor) and XL665 (acceptor). TR-FRET is observed when biotinylated histone monomethyl-H3K9 peptide is incubated with cryptate-labeled anti-dimethyl-histone H3K9 antibody (CisBio Cat#61KB2KAE) and streptavidin XL665 (CisBio Cat#610SAXLA), after enzymatic reaction of G9a.The human G9a enzyme expressed in a baculovirus infected Sf9 cell expression system was obtained from BPS Biosciences (Cat. #51001). Enzyme activity assay was carried out in a white 384-well plate in a final volume of 20 μl, as follow: 4 μl of vehicle or studied compound 2.5× concentrated prepared in assay buffer (50 mM Tris-HCl, 10 mM NaCl, 4 mM DTT, 0.01% Tween-20 pH9). Final percentage of DMSO was 0.5%. 2 μl of 1 nM G9a enzyme diluted in assay buffer. Final concentration was 0.2 nM. Start the reaction by adding 4 μl of substrate mixture containing 20 μM S-adenosylmethionine and 40 nM biotinylated histone monomethyl-H3K9 peptide. Reaction was carried out during 1 hour at room temperature. Enzyme activity was stopped by adding 5 μl of cryptate-labeled anti-dimethyl-histone H3K9 antibody. Final concentration 150 nM. Then, add 5 μl of streptavidin XL665 beads. Final concentration of 16 μM. Read the plate after 1 hour of incubation at room temperature.For each well, fluorescence was measured at 620 nm and 665 nm. A ratio (665 nm/620 nm) was then calculated in order to minimize medium interferences. Positive control was obtained in the presence of the vehicle of the compounds. Negative control was obtained in the absence of G9a enzyme activity. Calculated IC50 values were determined using GraphPrism using 4-parameters inhibition curve.
- Chemiluminescent Assay A PRMT5 chemiluminescent assay was used to measure the 1050 activity of PRMT5. Biotinylated histone peptides were synthesized and attached to 384-well plates. Compound serial dilutions were performed and added to the assay plate. Histone H4 monomethyl R3 antibody was obtained from Abcam. A master mix for each well was prepared and human PRMT5/MEP50 (expressed in HEK293 cells) diluted in assay buffer to a concentration of 5 ng/μL. The reaction was incubated and slowly rotated for 60 minutes at the point of PRMT5/MEP50 addition. The supernatant from the wells was removed and blocking buffer was added to each well and rotated for 10 minutes. The primary antibody was diluted and added to every well for 60 minutes, before it was removed and the wells washed. The horse radish peroxidase (HRP)-coupled secondary antibody was diluted and added to each well with an incubation time of 30 minutes. The HRP chemiluminescent substrate was added to every well. The plate was read on a Flourstar Omega BMG Labtech instrument (Ortenberg, Germany) and the analysis of IC50 was performed using the Flourstar Omega BMG Labtech software.
- Biological Activity Assay Assaying the inhibition of KDM1A can be determined in vitro, in cultured cells, and in animals. There are a variety of spectrophotometric methods to detect the results of demethylation of methylated lysines, viz., detecting the products of KDM1A demethylase oxidative activity on a peptide fragment of at least 18 amino acid representing the N-terminus of the histone H3 substrate that contains a monomethyl at the fourth lysine residue. Hydrogen peroxide, one product of the KDM1A demethylase reaction, reacts with horseradish peroxidase and dihydroxyphenoxazine (ADHP) to produce the fluorescent compound resorufin (excitation=530-560 nm:emission=590 nm). The KDM1A demethylase enzyme activity can obtained from mammalian cells or tissues expressing KDM1A from an endogenous or recombinant gene and purified or assayed from a whole cell extract. These methods can be used to determine the concentration of the disclosed compounds can inhibit fifty percent of the enzyme activity (IC50). In one aspect, the disclosed compounds exhibit inhibition fifty percent of the KDM1A enzyme activity at a concentration of less than 500 nM, less than 100 nM, less than 50 nM or less than 10 nM.
- Chemiluminescent Assay A PRMT5 chemiluminescent assay was used to measure the IC50 activity of PRMT5 of the compounds of Examples 1A to 7 above. Biotinylated histone peptides were synthesized and attached to 384-well plates. Compound serial dilutions were performed and added to the assay plate. Histone H4 monomethyl R3 antibody was obtained from Abcam. A master mix for each well was prepared and human PRMT5/MEP50 (expressed in HEK293 cells) diluted in assay buffer to a concentration of 5 ng/μL. The reaction was incubated and slowly rotated for 60 minutes at the point of PRMT5/MEP50 addition. The supernatant from the wells was removed and blocking buffer was added to each well and rotated for 10 minutes. The primary antibody was diluted and added to every well for 60 minutes, before it was removed and the wells washed. The horse raddish peroxidase (HRP)-coupled secondary antibody was diluted and added to each well with an incubation time of 30 minutes. The HRP chemiluminescent substrate was added to every well. The plate was read on a Flourstar Omega BMG Labtech instrument (Ortenberg, Germany) and the analysis of IC50 was performed using the Flourstar Omega BMG Labtech software.
- Test Method of EC50 of Anti HBV 8000 HepG 2.2.15 cells per well were seeded into a 96-well plate, the plate was cultured at 37° C. and 5% CO2 for 3 days till the cells grew to full wells. Old liquid medium can be removed and replaced with new medium (200 μL) on day 0.Formulating the compound and treating the cells in the experiment of anti virus: the compound was dissolved in DMSO to a concentration of 30 mM, and then the compound solution was diluted with DMSO to a concentration of 800M, and then eight dilutions at 4 fold were performed, the highest concentration is 800 μM. The serial diluted compound was added to the above plate at 1 μL per well, the highest final concentration in the experiment is 4 μM (200 fold dilution). TDF (tenofovir dipiroxil fumarate, Selleck, Cat S1400) has a highest concentration of 4 μM as a positive control. 1 μL of DMSO was added in to the positive control well at a final concentration of 0.5%, TDF was added in to the positive control well at a final concentration of 1 μM.Detection of Viral Genomic DNA by qPCRPrimer: HBV-For-202, CAGGCGGGGTTTTTCTTGTTGA; HBV-Rev-315, GTGATTGGAGGTTGGGGACTGC. Copies of virus can be calculated using a standard curve plotted by using plasmid containing HBV genome and using SYBR Premix Ex Taq II Takara DRR081S kit and 1 μL cell culture supernatant as a template. EC50 values of the compound on viral replication were calculated by a four parametric nonlinear regression model using Graphpad Prism 5 software to manage concentration viral copy number.
- Test of Anti HBV Activity In Vitro 8000 HepG 2.2.15 cells per well were seeded into a 96-well plate, the plate was cultured at 37° C. and 5% CO2 for 3 days till the cells grew to full wells. Old liquid medium can be removed and replaced with new medium (200 μL) on day 0.Formulating the compound and treating the cells in the experiment of anti virus: the compound was dissolved in DMSO to a concentration of 30 mM, and then the compound solution was diluted with DMSO to a concentration of 800 μM, and then eight dilutions at 4 fold were performed, the highest concentration is 800 μM. The serial diluted compound was added to the above plate at 1 μL per well, the highest final concentration in the experiment is 4 μM (200 fold dilution). TDF (tenofovir dipiroxil fumarate, Selleck, Cat S1400) has a highest concentration of 4 μM as a positive control. 1 μL of DMSO was added in to the positive control well at a final concentration of 0.5%, TDF was added in to the positive control well at a final concentration of 1 μM.Detection of Viral Genomic DNA by aPCRPrimer: HBV-For-202, CAGGCGGGGTTTTTCTTGTTGA; HBV-Rev-315, GTGATTGGAGGTTGGGGACTGC. Copies of virus can be calculated using a standard curve plotted by using plasmid containing HBV genome and using SYBR Premix Ex Taq II Takara DRR081S kit and 1 μL cell culture supernatant as a template. EC50 values of the compound on viral replication were calculated by a four parametric nonlinear regression model using Graphpad Prism 5 software to manage concentration viral copy number.