BDBM50478158 Tenofovir diphospahte tenofovir diphosphate
Tenofovir Exalidex hexadecyloxypropyl 9-(2-(phosphonomethoxy)propyl)adenine CMX-157 HDP-tenofovir BDBM77092 CMX157
BDBM77145 Tenofovir Tenofovir disoproxil 9-((R)-2-((Bis(((isopropoxycarbonyl)oxy)methoxy)phosphinyl)methoxy)propyl)adenine PMPA prodrug
Tenofovir Atripla BDBM50450813 Truvada CHEBI:63625 PMP-A GS-1275
- Pribut, N; D'Erasmo, M; Dasari, M; Giesler, KE; Iskandar, S; Sharma, SK; Bartsch, PW; Raghuram, A; Bushnev, A; Hwang, SS; Burton, SL; Derdeyn, CA; Basson, AE; Liotta, DC; Miller, EJ ?-Functionalized Lipid Prodrugs of HIV NtRTI Tenofovir with Enhanced Pharmacokinetic Properties. J Med Chem 64: 12917-12937 (2021)
- Tong, L; Phan, TK; Robinson, KL; Babusis, D; Strab, R; Bhoopathy, S; Hidalgo, IJ; Rhodes, GR; Ray, AS Effects of human immunodeficiency virus protease inhibitors on the intestinal absorption of tenofovir disoproxil fumarate in vitro. Antimicrob Agents Chemother 51: 3498-504 (2007)
- Marchand, B; White, KL; Ly, JK; Margot, NA; Wang, R; McDermott, M; Miller, MD; G?tte, M Effects of the translocation status of human immunodeficiency virus type 1 reverse transcriptase on the efficiency of excision of tenofovir. Antimicrob Agents Chemother 51: 2911-9 (2007)
- Frangeul, A; Barral, K; Alvarez, K; Canard, B In vitro suppression of K65R reverse transcriptase-mediated tenofovir- and adefovir-5'-diphosphate resistance conferred by the boranophosphonate derivatives. Antimicrob Agents Chemother 51: 3162-7 (2007)
- ChEMBL_2100811 Inhibition of human OAT1 assessed as reduction in OAT1-mediated tenofovir transport
- ChEMBL_2100812 Inhibition of human OAT3 assessed as reduction in OAT3-mediated tenofovir transport
- Anti-HIV Cytoprotection Assay The in vitro antiviral activity profile for CMX157 was evaluated for cell-type effects and HIV strain effects. It is active against all major subtypes of HIV-1 in PBMCs with EC50 values ranging between 0.20 and 7.18 nanomolar (nM). In a PHENOSENSE¿ assay, EC50s for CMX157 ranged from 0.66 nM for 74V/184V to 57 nM for 62V/69SVG/75I/215I; corresponding EC50s for tenofovir were 227 nM and 16,959 nM respectively (see FIG. 3). CMX157 IC50s for 41L/210W/215Y averaged 6.3 nM without 184V and 2.2 nM with 184V (2,240 and 770 nM for tenofovir respectively).
- Test Method of EC50 of Anti HBV 8000 HepG 2.2.15 cells per well were seeded into a 96-well plate, the plate was cultured at 37° C. and 5% CO2 for 3 days till the cells grew to full wells. Old liquid medium can be removed and replaced with new medium (200 μL) on day 0.Formulating the compound and treating the cells in the experiment of anti virus: the compound was dissolved in DMSO to a concentration of 30 mM, and then the compound solution was diluted with DMSO to a concentration of 800M, and then eight dilutions at 4 fold were performed, the highest concentration is 800 μM. The serial diluted compound was added to the above plate at 1 μL per well, the highest final concentration in the experiment is 4 μM (200 fold dilution). TDF (tenofovir dipiroxil fumarate, Selleck, Cat S1400) has a highest concentration of 4 μM as a positive control. 1 μL of DMSO was added in to the positive control well at a final concentration of 0.5%, TDF was added in to the positive control well at a final concentration of 1 μM.Detection of Viral Genomic DNA by qPCRPrimer: HBV-For-202, CAGGCGGGGTTTTTCTTGTTGA; HBV-Rev-315, GTGATTGGAGGTTGGGGACTGC. Copies of virus can be calculated using a standard curve plotted by using plasmid containing HBV genome and using SYBR Premix Ex Taq II Takara DRR081S kit and 1 μL cell culture supernatant as a template. EC50 values of the compound on viral replication were calculated by a four parametric nonlinear regression model using Graphpad Prism 5 software to manage concentration—viral copy number.
- Test of Anti HBV Activity In Vitro 8000 HepG 2.2.15 cells per well were seeded into a 96-well plate, the plate was cultured at 37° C. and 5% CO2 for 3 days till the cells grew to full wells. Old liquid medium can be removed and replaced with new medium (200 μL) on day 0.Formulating the compound and treating the cells in the experiment of anti virus: the compound was dissolved in DMSO to a concentration of 30 mM, and then the compound solution was diluted with DMSO to a concentration of 800 μM, and then eight dilutions at 4 fold were performed, the highest concentration is 800 μM. The serial diluted compound was added to the above plate at 1 μL per well, the highest final concentration in the experiment is 4 μM (200 fold dilution). TDF (tenofovir dipiroxil fumarate, Selleck, Cat S1400) has a highest concentration of 4 μM as a positive control. 1 μL of DMSO was added in to the positive control well at a final concentration of 0.5%, TDF was added in to the positive control well at a final concentration of 1 μM.Detection of Viral Genomic DNA by aPCRPrimer: HBV-For-202, CAGGCGGGGTTTTTCTTGTTGA; HBV-Rev-315, GTGATTGGAGGTTGGGGACTGC. Copies of virus can be calculated using a standard curve plotted by using plasmid containing HBV genome and using SYBR Premix Ex Taq II—Takara DRR081S kit and 1 μL cell culture supernatant as a template. EC50 values of the compound on viral replication were calculated by a four parametric nonlinear regression model using Graphpad Prism 5 software to manage concentration—viral copy number.