TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: 6.30E+3nMAssay Description:Displacement of 5-carboxyfluorescein-GpYDKPHVL-NH2 from mouse recombinant His-tagged STAT1-SH2 domain expressed in Escherichia coli BL21 (DE3) by flu...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: 1.65E+4nMAssay Description:Displacement of 5-carboxyfluorescein-GpYDKPHVL-NH2 from mouse recombinant His-tagged STAT1-SH2 domain expressed in Escherichia coli BL21 (DE3) by flu...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: >2.50E+4nMAssay Description:Inhibition of mouse STAT1 using fluorescent probe 5-carboxyfluorescein-GpYLPQTV-NH2 after 30 mins by fluorescence polarisation assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center
Curated by ChEMBL
University Of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 1.46E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center
Curated by ChEMBL
University Of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 2.61E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center
Curated by ChEMBL
University Of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 3.14E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center
Curated by ChEMBL
University Of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 4.71E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center
Curated by ChEMBL
University Of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 4.92E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 1.20E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: >2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: >2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: >2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: >2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: >3.00E+5nMAssay Description:Inhibition of STAT1 dimerization in EGF-stimulated mouse NIH/3T3 cells overexpressing human EGFR assessed as suppression of STAT1-DNA interaction aft...More data for this Ligand-Target Pair
