Compile Data Set for Download or QSAR
maximum 50k data
Found 2 Enz. Inhib. hit(s) with Target = 'Signal transducer and activator of transcription 3' and Ligand = 'BDBM50556875'
TargetSignal transducer and activator of transcription 3(Mus musculus (mouse))
University Of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM50556875(CHEMBL4754054 | US11299480, Example 80)
Affinity DataIC50:  710nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT3 SH2 domain in mouse NIH3T3/v-Src nuclear extract prei...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 3(Homo sapiens (Human))
University of Hawaii

US Patent
LigandPNGBDBM50556875(CHEMBL4754054 | US11299480, Example 80)
Affinity DataIC50:  711nMAssay Description:Nuclear extract preparations and DNA-binding activity/electrophoretic mobility shift assay (EMSA) were carried out as previously described (Zhang X, ...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails US Patent