Report error Found 550 Enz. Inhib. hit(s) with Target = 'Signal transducer and activator of transcription 1'
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataEC50: <2.83nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataKd: >10nMAssay Description:Binding affinity to human recombinant STAT1 assessed as dissociation constant incubated for 15 mins by biolayer interferometryMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataEC50: 64.3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataEC50: 71nMAssay Description:Inhibition of STAT1 phosphorylation in human SK-MES-1 cells pretreated for 30 mins followed by IL-6 stimulation by Western blot analysisMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataEC50: >76.4nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataEC50: >229nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 320nMAssay Description:Inhibition of IFN-gamma-induced STAT1 transcriptional activity in human HepG2 cells by luciferase reporter gene assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 350nMAssay Description:Inhibition of IFN-gamma-induced STAT1 transcriptional activity in human HepG2 cells by luciferase reporter gene assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataEC50: >688nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataKd: 700nMAssay Description:Binding affinity to STAT1 (unknown origin) by surface plasmon resonance assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataEC50: 835nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 880nMAssay Description:Inhibition of IFN-gamma-induced STAT1 transcriptional activity in human HepG2 cells by luciferase reporter gene assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataKd: 1.00E+3nMAssay Description:Binding affinity to recombinant human His/SUMO-tagged STAT1 (132 to 713 residues) expressed in Escherichia coli Rosetta (DE3) incubated for 1 hr by f...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataKd: 1.00E+3nMAssay Description:Binding affinity to His-tagged human STAT1 (132 to 713 residues) expressed in Escherichia coli Rosette (DE3) assessed as dissociation constant using ...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center
Curated by ChEMBL
University of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 1.46E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 2.00E+3nMAssay Description:Inhibition of Stat1 (unknown origin) expressed in LPS/INF-gamma-stimulated human MONO-MAC-6 cells assessed as reduction in GAS dependent transcriptio...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 2.00E+3nMAssay Description:Inhibition of Stat1 (unknown origin) expressed in LPS/INF-gamma-stimulated human MONO-MAC-6 cells assessed as reduction in GAS dependent transcriptio...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataEC50: 2.01E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center
Curated by ChEMBL
University of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 2.61E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center
Curated by ChEMBL
University of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 3.14E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataKi: 3.20E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataEC50: 3.31E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 3.47E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 3.52E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataEC50: 4.04E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 4.24E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 4.36E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 4.42E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataKd: 4.67E+3nMAssay Description:Binding affinity to STAT1 (unknown origin) by surface plasmon resonance assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center
Curated by ChEMBL
University of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 4.71E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center
Curated by ChEMBL
University of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 4.92E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 5.20E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 5.80E+3nMAssay Description:Binding affinity to Stat1 (unknown origin) using 5-FAM-GpYLPQTV-NH2 as probe assessed as phosphopetide complex formation after 30 mins by fluorescenc...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 5.90E+3nMAssay Description:Inhibition of IFNgamma-induced STAT1 phosphorylation in human Cal33 cells by Western blot analysisMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 6.19E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1(Mouse)
University of Toronto
Curated by ChEMBL
University of Toronto
Curated by ChEMBL
Affinity DataKi: 6.30E+3nMAssay Description:Displacement of 5-carboxyfluorescein-GpYDKPHVL-NH2 from mouse recombinant His-tagged STAT1-SH2 domain expressed in Escherichia coli BL21 (DE3) by flu...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 6.37E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 6.70E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 7.00E+3nMAssay Description:Inhibition of Stat1 (unknown origin) expressed in LPS/INF-gamma-stimulated human MONO-MAC-6 cells assessed as reduction in GAS dependent transcriptio...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 7.87E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 7.89E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 7.90E+3nMAssay Description:Inhibition of 5-carboxyfluorescein-GpYDKPHVL-OH binding to STAT1 (unknown origin) pre-incubated for 1 hr before fluorescent-labelled peptide addition...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 8.43E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataKi: 8.80E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 9.10E+3nMAssay Description:Inhibition of 5-carboxyfluorescein-GpYDKPHVL-OH binding to STAT1 (unknown origin) pre-incubated for 1 hr before fluorescent-labelled peptide addition...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 9.25E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 9.39E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataKi: 9.50E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataIC50: 9.58E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
The Scripps Research Institute Molecular Screening Center
Curated by PubChem BioAssay
Affinity DataKi: 9.70E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
















































