Compile Data Set for Download or QSAR
Report error Found 550 Enz. Inhib. hit(s) with Target = 'Signal transducer and activator of transcription 1'
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50131053(10-Methoxy-8,13-dihydro-7H-indolo[2',3':3,4]pyrido...)
Affinity DataEC50: <2.83nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
7/29/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50557878(CHEMBL4776801)
Affinity DataKd: >10nMAssay Description:Binding affinity to human recombinant STAT1 assessed as dissociation constant incubated for 15 mins by biolayer interferometryMore data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM68332(cid_42640807 | SR-03000000931-1 | 7-(4-fluoropheny...)
Affinity DataEC50:  64.3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
7/29/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50631296(CHEMBL5397297)
Affinity DataEC50:  71nMAssay Description:Inhibition of STAT1 phosphorylation in human SK-MES-1 cells pretreated for 30 mins followed by IL-6 stimulation by Western blot analysisMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/21/2024
Entry Details
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43676(N-1,3-benzothiazol-2-yl-5-methyl-2-thiophenecarbox...)
Affinity DataEC50: >76.4nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
7/29/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM68333(5-methyl-3-phenyl-7-(4-pyridyl)pyrazolo[1,5-a]pyri...)
Affinity DataEC50: >229nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
7/29/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50569071(CHEMBL4846365)
Affinity DataIC50: 320nMAssay Description:Inhibition of IFN-gamma-induced STAT1 transcriptional activity in human HepG2 cells by luciferase reporter gene assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
8/20/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50569070(CHEMBL4864495)
Affinity DataIC50: 350nMAssay Description:Inhibition of IFN-gamma-induced STAT1 transcriptional activity in human HepG2 cells by luciferase reporter gene assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
8/20/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43688(SMR000146251 | MLS000552736 | (E)-2-(1H-Benzoimida...)
Affinity DataEC50: >688nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
7/29/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50070942((-)-Epigallocatechin-3-o-gallate | (-)-Epigallocat...)
Affinity DataKd:  700nMAssay Description:Binding affinity to STAT1 (unknown origin) by surface plasmon resonance assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
7/26/2014
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM68331(cid_8379104 | SR-03000000815-1 | N-(1,3-benzothiaz...)
Affinity DataEC50:  835nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
7/29/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50569085(CHEMBL4846078)
Affinity DataIC50: 880nMAssay Description:Inhibition of IFN-gamma-induced STAT1 transcriptional activity in human HepG2 cells by luciferase reporter gene assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
8/20/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50514302(CHEMBL4452527)
Affinity DataKd:  1.00E+3nMAssay Description:Binding affinity to recombinant human His/SUMO-tagged STAT1 (132 to 713 residues) expressed in Escherichia coli Rosetta (DE3) incubated for 1 hr by f...More data for this Ligand-Target Pair
In Depth
Date in BDB:
2/21/2021
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50514302(CHEMBL4452527)
Affinity DataKd:  1.00E+3nMAssay Description:Binding affinity to His-tagged human STAT1 (132 to 713 residues) expressed in Escherichia coli Rosette (DE3) assessed as dissociation constant using ...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/21/2023
Entry Details
PubMed
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM549118(BDBM50556884 | US11299480, Example 53)
Affinity DataIC50: 1.46E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50207367(CHEMBL3952820)
Affinity DataIC50: 2.00E+3nMAssay Description:Inhibition of Stat1 (unknown origin) expressed in LPS/INF-gamma-stimulated human MONO-MAC-6 cells assessed as reduction in GAS dependent transcriptio...More data for this Ligand-Target Pair
In Depth
Date in BDB:
8/28/2018
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50207369(CHEMBL3968323)
Affinity DataIC50: 2.00E+3nMAssay Description:Inhibition of Stat1 (unknown origin) expressed in LPS/INF-gamma-stimulated human MONO-MAC-6 cells assessed as reduction in GAS dependent transcriptio...More data for this Ligand-Target Pair
In Depth
Date in BDB:
8/28/2018
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43697(3-[4-(4-methoxyphenyl)-1,3-thiazol-2-yl]-2-thioxo-...)
Affinity DataEC50:  2.01E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
7/29/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM549075(BDBM50556877 | US11299480, Example 34)
Affinity DataIC50: 2.61E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM549125(US11299480, Example 135 | BDBM50556925)
Affinity DataIC50: 3.14E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50382460(CHEMBL2023985 | US10196373, Compound 27NA)
Affinity DataKi:  3.20E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
2/7/2013
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43686(MLS000533371 | ethyl (E)-2-cyano-3-(2,5-dimethyl-1...)
Affinity DataEC50:  3.31E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
7/29/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43505(ethyl 4-[4-(4-oxidanylidene-2-sulfanylidene-1H-qui...)
Affinity DataIC50: 3.47E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43529(2-(4-methylphenyl)-5-pyridin-4-yl-4H-benzo[i][1,3,...)
Affinity DataIC50: 3.52E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43736(SMR000295608 | 7-(4-methoxyphenyl)-5-methyl-3-phen...)
Affinity DataEC50:  4.04E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
7/29/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43519(3-[[4-(2-fluorophenyl)-1,3-thiazol-2-yl]methyl]-2-...)
Affinity DataIC50: 4.24E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43527(cid_5686694 | MLS000394219 | 2-[(7-hydroxy-2-oxo-1...)
Affinity DataIC50: 4.36E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43517(SMR000218837 | N'-[(1,3-diethyl-4,6-dioxo-2-sulfan...)
Affinity DataIC50: 4.42E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50448069(CHEMBL3120621)
Affinity DataKd:  4.67E+3nMAssay Description:Binding affinity to STAT1 (unknown origin) by surface plasmon resonance assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
7/26/2014
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM549132(BDBM50556940 | US11299480, Example 138)
Affinity DataIC50: 4.71E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM50556895(CHEMBL4760561)
Affinity DataIC50: 4.92E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43512(MLS000544969 | 3-(3,4-dimethylphenyl)-4-oxo-3,4-di...)
Affinity DataIC50: 5.20E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50440967(CHEMBL2431993 | US10196373, Compound BP2-061)
Affinity DataIC50: 5.80E+3nMAssay Description:Binding affinity to Stat1 (unknown origin) using 5-FAM-GpYLPQTV-NH2 as probe assessed as phosphopetide complex formation after 30 mins by fluorescenc...More data for this Ligand-Target Pair
In Depth
Date in BDB:
4/13/2014
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM196138(US9211296, Table 7, Compd: 9)
Affinity DataIC50: 5.90E+3nMAssay Description:Inhibition of IFNgamma-induced STAT1 phosphorylation in human Cal33 cells by Western blot analysisMore data for this Ligand-Target Pair
In Depth
Date in BDB:
11/4/2016
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43507(SMR000082759 | 4-[4-(2-methoxyphenyl)-6-(trifluoro...)
Affinity DataIC50: 6.19E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1(Mouse)
University of Toronto

Curated by ChEMBL
LigandPNGBDBM50337199(4-((S)-3-((S)-1-(6-(Benzylcarbamoyl)-4'-carbamoylb...)
Affinity DataKi:  6.30E+3nMAssay Description:Displacement of 5-carboxyfluorescein-GpYDKPHVL-NH2 from mouse recombinant His-tagged STAT1-SH2 domain expressed in Escherichia coli BL21 (DE3) by flu...More data for this Ligand-Target Pair
In Depth
Date in BDB:
8/23/2011
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43511(diethyl 2-[[(5-methyl-2-phenylpyrazol-3-yl)amino]m...)
Affinity DataIC50: 6.37E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM36973(SMR000064688 | MLS000056603 | 1-[[5-[5-(4-methylph...)
Affinity DataIC50: 6.70E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50207368(CHEMBL3904582)
Affinity DataIC50: 7.00E+3nMAssay Description:Inhibition of Stat1 (unknown origin) expressed in LPS/INF-gamma-stimulated human MONO-MAC-6 cells assessed as reduction in GAS dependent transcriptio...More data for this Ligand-Target Pair
In Depth
Date in BDB:
8/28/2018
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43521(MLS000394345 | N-(4-fluorophenyl)-2-[4-(4-methylph...)
Affinity DataIC50: 7.87E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM39665((2E)-2-[(3-methylthiophen-2-yl)methylidene]-3,4-di...)
Affinity DataIC50: 7.89E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/28/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50240455(CHEMBL1253351)
Affinity DataIC50: 7.90E+3nMAssay Description:Inhibition of 5-carboxyfluorescein-GpYDKPHVL-OH binding to STAT1 (unknown origin) pre-incubated for 1 hr before fluorescent-labelled peptide addition...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/3/2020
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43510(5-(phenylmethyl)-3-pyrrolidin-1-ylcarbonyl-benzo[b...)
Affinity DataIC50: 8.43E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50353444(CHEMBL1829870 | US10196373, Compound 45C)
Affinity DataKi:  8.80E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
2/7/2013
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50000029(suramin | SURAMIN HEXASODIUM | CHEMBL265502 | 4-Me...)
Affinity DataIC50: 9.10E+3nMAssay Description:Inhibition of 5-carboxyfluorescein-GpYDKPHVL-OH binding to STAT1 (unknown origin) pre-incubated for 1 hr before fluorescent-labelled peptide addition...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/3/2020
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43508(cid_2802825 | N-[1-(4-methyl-6-oxidanylidene-pyrim...)
Affinity DataIC50: 9.25E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43526(2-[[2-(2,4-dihydroxyphenyl)-2-oxoethyl]thio]-1H-qu...)
Affinity DataIC50: 9.39E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50382459(CHEMBL2023986 | US10196373, Compound 27NH)
Affinity DataKi:  9.50E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
2/7/2013
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM43520(2-[(4-methylpiperazino)methyl]-3-[[4-(2-naphthyl)t...)
Affinity DataIC50: 9.58E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/21/2011
Entry Details
PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Human)
The Scripps Research Institute Molecular Screening Center

Curated by PubChem BioAssay
LigandPNGBDBM50353445(CHEMBL1829862 | US10196373, Compound 45B)
Affinity DataKi:  9.70E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
2/7/2013
Entry Details Article
PubMed
Displayed 1 to 50 (of 550 total ) | Next | Last >>
Jump to: