TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 540nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 590nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 620nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 670nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 700nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 740nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 760nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 780nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 790nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 860nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 870nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 880nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 920nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.30E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.30E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.50E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.70E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.80E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.90E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 1.90E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 2.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 2.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 2.30E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89-C using dsDNA substrate preincubated for 15 mins followed by substrate addition for 1 hr by ELISAMore data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 2.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 2.70E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 2.80E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 3.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 3.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 3.30E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 3.50E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 3.50E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 3.60E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 3.80E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 4.20E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89-C using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcac ssDNA as substr...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 4.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 4.50E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 5.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 5.70E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 5.70E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 5.80E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 6.20E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89-CMore data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 6.20E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
TargetTripartite terminase subunit 3(Human cytomegalovirus (strain AD169) (HHV-5) (Huma...)
University Of Minnesota
Curated by ChEMBL
University Of Minnesota
Curated by ChEMBL
Affinity DataIC50: 6.50E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair