Compile Data Set for Download or QSAR
maximum 50k data
Found 6 of ic50 for UniProtKB: P42225
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM549075(BDBM50556877 | US11299480, Example 34)
Affinity DataIC50:  1.20E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM549118(BDBM50556884 | US11299480, Example 53)
Affinity DataIC50: >2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM549132(BDBM50556940 | US11299480, Example 138)
Affinity DataIC50: >2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM50556895(CHEMBL4760561)
Affinity DataIC50: >2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM549125(BDBM50556925 | US11299480, Example 135)
Affinity DataIC50: >2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM20283(2-hydroxy-4-(2-{[(4-methylbenzene)sulfonyl]oxy}ace...)
Affinity DataIC50: >3.00E+5nMAssay Description:Inhibition of STAT1 dimerization in EGF-stimulated mouse NIH/3T3 cells overexpressing human EGFR assessed as suppression of STAT1-DNA interaction aft...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed