| Assay Method Information | |
| | WRN activity Format A |
| Description: | Full length WRN protein (aa 2-1432) (production described separately) was used for the biochemical activity assays. The 39-mer ssDNA “C6.18” (CAGCTATGGGACATTTGATACCGAGCAACAATTCACTGG) was purchased from IDT and used as a substrate. Quantification of ATP hydrolysis was evaluated using the ADP-Glo assay kit (Promega, Madison, WI). An enzyme titration time-course was performed to determine the optimal assay conditions. Based on these results, the assay setup included 0.25nM WRN protein, 100nM C6.18 ssDNA, and 10μM ATP in the following assay buffer: 20mM HEPES, pH 7.5, 100mM KCl, 1.5mM MgCl2, 0.01% NP-40, 3% glycerol, 5mM EGTA, 0.5mM DTT, 0.1mg/mL BSA prepared in MilliQ water. To evaluate the inhibitory effects of the compounds, 11-point 3-fold serial dilutions were prepared in DMSO.50nL of each concentration in duplicate was preincubated for 30 minutes in a 384-well microplate (Greiner #784075) with 5μL of 0.5nM WRN in assay buffer. The reaction was initiated by adding 5μL of 200nM C6.18 DNA with 20μM ATP and was allowed to proceed for 30 minutes at room temperature. The reaction was stopped with 10μL ADP-Glo reagent for 1 hour to remove unreacted ATP. Lastly, 20μL ATP detection reagent was added and incubated for 1 hour to generate the luminescence signal. Control wells included “high controls” with no inhibition (DMSO, no compound) and “low controls” with maximum inhibition (no WRN). Luminescence was recorded on a PHERAstar (BMG Labtech, Ortenberg, Germany). Data was fit using the “Smart Fit” method within the Genedata Screener Software (Basel, Switzerland) to obtain IC50 values using four-parameter fits. Reported IC50s are the geometric means of at least two independent trials. |
| Affinity data for this assay | |
|---|---|
| If you find an error in this entry please send us an E-mail | |