Affinity DataIC50: 20nMAssay Description:Inhibition of HIV integraseMore data for this Ligand-Target Pair
TargetIntegrase(Human immunodeficiency virus 1)
Fondazione Cenci Bolognettiuniversit£
Curated by ChEMBL
Fondazione Cenci Bolognettiuniversit£
Curated by ChEMBL
Affinity DataIC50: 50nMAssay Description:Inhibition of recombinant HIV1 integrase strand transfer activity by high throughput electrochemiluminescent assay in presence of magnesiumMore data for this Ligand-Target Pair
Affinity DataIC50: 50nMAssay Description:Strand transfer inhibitory activity against HIV-1 integraseMore data for this Ligand-Target Pair
TargetIntegrase(Human immunodeficiency virus 1)
Fondazione Cenci Bolognettiuniversit£
Curated by ChEMBL
Fondazione Cenci Bolognettiuniversit£
Curated by ChEMBL
Affinity DataIC50: 57nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
TargetIntegrase(Human immunodeficiency virus 1)
Fondazione Cenci Bolognettiuniversit£
Curated by ChEMBL
Fondazione Cenci Bolognettiuniversit£
Curated by ChEMBL
Affinity DataIC50: 80nMAssay Description:Inhibition of HIV-1 HXB2 integrase using 32P-labelled oligonucleotide as substrate after 1 hr by phosphorimager analysisMore data for this Ligand-Target Pair
Affinity DataIC50: 126nMAssay Description:Inhibitory activity against HIV-1 integraseMore data for this Ligand-Target Pair
Affinity DataIC50: 170nMAssay Description:Inhibition of recombinant HIV-1 Integrase in strand transfer enzyme assay.More data for this Ligand-Target Pair
Affinity DataIC50: 300nMAssay Description:Inhibition of HIV1 recombinant integraseMore data for this Ligand-Target Pair
TargetIntegrase(Human immunodeficiency virus 1)
Fondazione Cenci Bolognettiuniversit£
Curated by ChEMBL
Fondazione Cenci Bolognettiuniversit£
Curated by ChEMBL
Affinity DataIC50: 400nMAssay Description:Inhibition of HIV integrase pre-incubated for 10 mins before addition of oligo-5'-biotin ATGTGGAAAATCTCTAGCA annealed with ACTGCTAGAGATTTTCCACAT 3'-C...More data for this Ligand-Target Pair
Affinity DataIC50: 500nMAssay Description:Inhibition of HIV-1 integrase catalytic activityMore data for this Ligand-Target Pair
TargetIntegrase(Human immunodeficiency virus 1)
Fondazione Cenci Bolognettiuniversit£
Curated by ChEMBL
Fondazione Cenci Bolognettiuniversit£
Curated by ChEMBL
Affinity DataIC50: 540nMAssay Description:Inhibition of HIV1 integrase strand transfer activity by PAGEMore data for this Ligand-Target Pair
Affinity DataIC50: 540nMAssay Description:Inhibition of HIV1 integrase strand transfer activityMore data for this Ligand-Target Pair
Affinity DataIC50: 2.00E+3nMAssay Description:Inhibitory activity against HIV-1 integrase.More data for this Ligand-Target Pair
Affinity DataIC50: 2.00E+3nMAssay Description:Inhibitory activity against HIV-1 integrase.More data for this Ligand-Target Pair
Affinity DataIC50: 1.45E+4nMAssay Description:Evaluated for inhibition of HIV-1 integrase catalytic activity in terms of inhibition of 3'-processingMore data for this Ligand-Target Pair
Affinity DataIC50: 1.50E+4nMAssay Description:Inhibition of HIV1 integrase 3' processing activityMore data for this Ligand-Target Pair
TargetIntegrase(Human immunodeficiency virus 1)
Fondazione Cenci Bolognettiuniversit£
Curated by ChEMBL
Fondazione Cenci Bolognettiuniversit£
Curated by ChEMBL
Affinity DataIC50: 1.50E+4nMAssay Description:Inhibition of HIV1 integrase 3' processing activity by PAGEMore data for this Ligand-Target Pair