TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: 3.20E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: 6.30E+3nMAssay Description:Displacement of 5-carboxyfluorescein-GpYDKPHVL-NH2 from mouse recombinant His-tagged STAT1-SH2 domain expressed in Escherichia coli BL21 (DE3) by flu...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: 8.80E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: 9.50E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: 9.70E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: 1.65E+4nMAssay Description:Displacement of 5-carboxyfluorescein-GpYDKPHVL-NH2 from mouse recombinant His-tagged STAT1-SH2 domain expressed in Escherichia coli BL21 (DE3) by flu...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: 2.20E+4nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: >2.50E+4nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: >2.50E+4nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: >2.50E+4nMAssay Description:Inhibition of mouse STAT1 using fluorescent probe 5-carboxyfluorescein-GpYLPQTV-NH2 after 30 mins by fluorescence polarisation assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: >2.50E+4nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: >2.50E+4nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataKi: 2.78E+4nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 320nMAssay Description:Inhibition of IFN-gamma-induced STAT1 transcriptional activity in human HepG2 cells by luciferase reporter gene assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 350nMAssay Description:Inhibition of IFN-gamma-induced STAT1 transcriptional activity in human HepG2 cells by luciferase reporter gene assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 880nMAssay Description:Inhibition of IFN-gamma-induced STAT1 transcriptional activity in human HepG2 cells by luciferase reporter gene assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center
Curated by ChEMBL
University Of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 1.46E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 2.00E+3nMAssay Description:Inhibition of Stat1 (unknown origin) expressed in LPS/INF-gamma-stimulated human MONO-MAC-6 cells assessed as reduction in GAS dependent transcriptio...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 2.00E+3nMAssay Description:Inhibition of Stat1 (unknown origin) expressed in LPS/INF-gamma-stimulated human MONO-MAC-6 cells assessed as reduction in GAS dependent transcriptio...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center
Curated by ChEMBL
University Of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 2.61E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center
Curated by ChEMBL
University Of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 3.14E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 3.47E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 3.52E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 4.24E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 4.36E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 4.42E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center
Curated by ChEMBL
University Of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 4.71E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center
Curated by ChEMBL
University Of Hawaii Cancer Center
Curated by ChEMBL
Affinity DataIC50: 4.92E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 5.20E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 5.80E+3nMAssay Description:Binding affinity to Stat1 (unknown origin) using 5-FAM-GpYLPQTV-NH2 as probe assessed as phosphopetide complex formation after 30 mins by fluorescenc...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 5.90E+3nMAssay Description:Inhibition of IFNgamma-induced STAT1 phosphorylation in human Cal33 cells by Western blot analysisMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: >6.19E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 6.37E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 6.70E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 7.00E+3nMAssay Description:Inhibition of Stat1 (unknown origin) expressed in LPS/INF-gamma-stimulated human MONO-MAC-6 cells assessed as reduction in GAS dependent transcriptio...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 7.87E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 7.89E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 7.90E+3nMAssay Description:Inhibition of 5-carboxyfluorescein-GpYDKPHVL-OH binding to STAT1 (unknown origin) pre-incubated for 1 hr before fluorescent-labelled peptide addition...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 8.43E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 9.10E+3nMAssay Description:Inhibition of 5-carboxyfluorescein-GpYDKPHVL-OH binding to STAT1 (unknown origin) pre-incubated for 1 hr before fluorescent-labelled peptide addition...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 9.25E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 9.39E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 9.58E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 9.87E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 9.97E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 1.00E+4nMAssay Description:Inhibition of STAT1 SH2 domain assessed as inhibition of STAT1 SH2-phosphotyrosine interaction by AlphaScreen assayMore data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 1.02E+4nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 1.05E+4nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 1.05E+4nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto
Curated by ChEMBL
University Of Toronto
Curated by ChEMBL
Affinity DataIC50: 1.07E+4nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair