Compile Data Set for Download or QSAR
maximum 50k data
Found 549 Enz. Inhib. hit(s) with Target = 'Signal transducer and activator of transcription 1'
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50382460(CHEMBL2023985 | US10196373, Compound 27NA)
Affinity DataKi:  3.20E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50337199(4-((S)-3-((S)-1-(6-(Benzylcarbamoyl)-4'-carbamoylb...)
Affinity DataKi:  6.30E+3nMAssay Description:Displacement of 5-carboxyfluorescein-GpYDKPHVL-NH2 from mouse recombinant His-tagged STAT1-SH2 domain expressed in Escherichia coli BL21 (DE3) by flu...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50353444(CHEMBL1829870 | US10196373, Compound 45C)
Affinity DataKi:  8.80E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50382459(CHEMBL2023986 | US10196373, Compound 27NH)
Affinity DataKi:  9.50E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50353445(CHEMBL1829862 | US10196373, Compound 45B)
Affinity DataKi:  9.70E+3nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50337198((S)-3-(((S)-1-((5-(Benzylcarbamoyl)-4'-carbamoyl-[...)
Affinity DataKi:  1.65E+4nMAssay Description:Displacement of 5-carboxyfluorescein-GpYDKPHVL-NH2 from mouse recombinant His-tagged STAT1-SH2 domain expressed in Escherichia coli BL21 (DE3) by flu...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50353435(CHEMBL1829874 | US10196373, Compound 45K)
Affinity DataKi:  2.20E+4nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50382464(CHEMBL2024086)
Affinity DataKi: >2.50E+4nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50353441(CHEMBL1829786)
Affinity DataKi: >2.50E+4nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1(Mus musculus)
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50353441(CHEMBL1829786)
Affinity DataKi: >2.50E+4nMAssay Description:Inhibition of mouse STAT1 using fluorescent probe 5-carboxyfluorescein-GpYLPQTV-NH2 after 30 mins by fluorescence polarisation assayMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50382461(CHEMBL2023987 | US10196373, Compound 27KG)
Affinity DataKi: >2.50E+4nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50382463(CHEMBL2023989)
Affinity DataKi: >2.50E+4nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50382462(CHEMBL2023988 | US10196373, Compound 27KI)
Affinity DataKi:  2.78E+4nMAssay Description:Displacement of radioligand from the STAT1 after 15 mins by fluorescent polarization assayMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50569071(CHEMBL4846365)
Affinity DataIC50:  320nMAssay Description:Inhibition of IFN-gamma-induced STAT1 transcriptional activity in human HepG2 cells by luciferase reporter gene assayMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50569070(CHEMBL4864495)
Affinity DataIC50:  350nMAssay Description:Inhibition of IFN-gamma-induced STAT1 transcriptional activity in human HepG2 cells by luciferase reporter gene assayMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50569085(CHEMBL4846078)
Affinity DataIC50:  880nMAssay Description:Inhibition of IFN-gamma-induced STAT1 transcriptional activity in human HepG2 cells by luciferase reporter gene assayMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM549118(BDBM50556884 | US11299480, Example 53)
Affinity DataIC50:  1.46E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50207369(CHEMBL3968323)
Affinity DataIC50:  2.00E+3nMAssay Description:Inhibition of Stat1 (unknown origin) expressed in LPS/INF-gamma-stimulated human MONO-MAC-6 cells assessed as reduction in GAS dependent transcriptio...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50207367(CHEMBL3952820)
Affinity DataIC50:  2.00E+3nMAssay Description:Inhibition of Stat1 (unknown origin) expressed in LPS/INF-gamma-stimulated human MONO-MAC-6 cells assessed as reduction in GAS dependent transcriptio...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM549075(BDBM50556877 | US11299480, Example 34)
Affinity DataIC50:  2.61E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM549125(BDBM50556925 | US11299480, Example 135)
Affinity DataIC50:  3.14E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43505(4-[4-(4-keto-2-thioxo-1H-quinazolin-3-yl)benzoyl]p...)
Affinity DataIC50:  3.47E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43529(2-(4-methylphenyl)-5-pyridin-4-yl-4H-benzo[i][1,3,...)
Affinity DataIC50:  3.52E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43519(3-[[4-(2-fluorophenyl)-1,3-thiazol-2-yl]methyl]-2-...)
Affinity DataIC50:  4.24E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43527(2-[(7-hydroxy-2-keto-chromen-4-yl)methylthio]-1H-q...)
Affinity DataIC50:  4.36E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43517(Isonicotinic acid N'-(1,3-diethyl-4,6-dioxo-2-...)
Affinity DataIC50:  4.42E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM549132(BDBM50556940 | US11299480, Example 138)
Affinity DataIC50:  4.71E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1/3(Mus musculus (mouse))
University Of Hawaii Cancer Center

Curated by ChEMBL
LigandPNGBDBM50556895(CHEMBL4760561)
Affinity DataIC50:  4.92E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43512(3-(3,4-dimethylphenyl)-4-keto-phthalazine-1-carbox...)
Affinity DataIC50:  5.20E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50440967(CHEMBL2431993 | US10196373, Compound BP2-061)
Affinity DataIC50:  5.80E+3nMAssay Description:Binding affinity to Stat1 (unknown origin) using 5-FAM-GpYLPQTV-NH2 as probe assessed as phosphopetide complex formation after 30 mins by fluorescenc...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM196138(US9211296, Table 7, Compd: 9)
Affinity DataIC50:  5.90E+3nMAssay Description:Inhibition of IFNgamma-induced STAT1 phosphorylation in human Cal33 cells by Western blot analysisMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43507(4-(4-{[4-(2-methoxyphenyl)-6-(trifluoromethyl)-2-p...)
Affinity DataIC50: >6.19E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43511(2-[[(5-methyl-2-phenyl-3-pyrazolyl)amino]methylide...)
Affinity DataIC50:  6.37E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM36973(1-[[5-[5-(4-methylphenyl)thieno[2,3-d]pyrimidin-4-...)
Affinity DataIC50:  6.70E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50207368(CHEMBL3904582)
Affinity DataIC50:  7.00E+3nMAssay Description:Inhibition of Stat1 (unknown origin) expressed in LPS/INF-gamma-stimulated human MONO-MAC-6 cells assessed as reduction in GAS dependent transcriptio...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43521(MLS000394345 | N-(4-fluorophenyl)-2-[4-(4-methylph...)
Affinity DataIC50:  7.87E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM39665((2E)-2-[(3-methyl-2-thienyl)methylene]tetralin-1-o...)
Affinity DataIC50:  7.89E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50240455(CHEMBL1253351)
Affinity DataIC50:  7.90E+3nMAssay Description:Inhibition of 5-carboxyfluorescein-GpYDKPHVL-OH binding to STAT1 (unknown origin) pre-incubated for 1 hr before fluorescent-labelled peptide addition...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43510(3-[oxo(1-pyrrolidinyl)methyl]-5-(phenylmethyl)-6-b...)
Affinity DataIC50:  8.43E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50000029(4-Methyl-8-{4-methyl-3-[3-(3-{3-[2-methyl-5-(4,6,8...)
Affinity DataIC50:  9.10E+3nMAssay Description:Inhibition of 5-carboxyfluorescein-GpYDKPHVL-OH binding to STAT1 (unknown origin) pre-incubated for 1 hr before fluorescent-labelled peptide addition...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43508(MLS000526191 | N-[1-(4-Methyl-6-oxo-6H-pyrimidin-1...)
Affinity DataIC50:  9.25E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43526(2-[2-(2,4-dihydroxyphenyl)-2-oxoethyl]sulfanyl-1H-...)
Affinity DataIC50:  9.39E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43520(2-[(4-methyl-1-piperazinyl)methyl]-3-[[4-(2-naphth...)
Affinity DataIC50:  9.58E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM46374(1-(1-acetyl-2,3-dihydroindol-5-yl)-4-hydroxy-3-pyr...)
Affinity DataIC50:  9.87E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM31063(2-(methylsulfonyl)-4-phenyl-6-(trifluoromethyl)pyr...)
Affinity DataIC50:  9.97E+3nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM50396176(CHEMBL207155)
Affinity DataIC50:  1.00E+4nMAssay Description:Inhibition of STAT1 SH2 domain assessed as inhibition of STAT1 SH2-phosphotyrosine interaction by AlphaScreen assayMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43506(3-[4-phenyl-6-(trifluoromethyl)pyrimidin-2-yl]sulf...)
Affinity DataIC50:  1.02E+4nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43541(2-[(4-methyl-1-piperazinyl)methyl]-3-[[4-(3-nitrop...)
Affinity DataIC50:  1.05E+4nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43534(MLS000692834 | N-[[(Z)-2-bromanyl-3-phenyl-prop-2-...)
Affinity DataIC50:  1.05E+4nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PCBioAssay
TargetSignal transducer and activator of transcription 1-alpha/beta(Homo sapiens (Human))
University Of Toronto

Curated by ChEMBL
LigandPNGBDBM43513(3-(4-Phenyl-6-trifluoromethyl-pyrimidine-2-sulfony...)
Affinity DataIC50:  1.07E+4nMAssay Description:Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center Center Affiliation: The Scripps Research Institute (TSRI) Assay...More data for this Ligand-Target Pair
In DepthDetails PCBioAssay
Displayed 1 to 50 (of 549 total ) | Next | Last >>
Jump to: