Compile Data Set for Download or QSAR
Report error Found 14 for UniProtKB: P42225
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 549118BDBM549118(BDBM50556884 | US11299480, Example 53)
Affinity DataIC50: 1.46E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 549075BDBM549075(BDBM50556877 | US11299480, Example 34)
Affinity DataIC50: 2.61E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 549125BDBM549125(US11299480, Example 135 | BDBM50556925)
Affinity DataIC50: 3.14E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 549132BDBM549132(BDBM50556940 | US11299480, Example 138)
Affinity DataIC50: 4.71E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1/3(Mouse)
University of Hawaii Cancer Center

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50556895BDBM50556895(CHEMBL4760561)
Affinity DataIC50: 4.92E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1(Mouse)
University of Toronto

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50337199BDBM50337199(4-((S)-3-((S)-1-(6-(Benzylcarbamoyl)-4'-carbamoylb...)
Affinity DataKi:  6.30E+3nMAssay Description:Displacement of 5-carboxyfluorescein-GpYDKPHVL-NH2 from mouse recombinant His-tagged STAT1-SH2 domain expressed in Escherichia coli BL21 (DE3) by flu...More data for this Ligand-Target Pair
In Depth
Date in BDB:
8/23/2011
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1(Mouse)
University of Toronto

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 549075BDBM549075(BDBM50556877 | US11299480, Example 34)
Affinity DataIC50: 1.20E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1(Mouse)
University of Toronto

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50337198BDBM50337198((S)-3-(((S)-1-((5-(Benzylcarbamoyl)-4'-carbamoyl-[...)
Affinity DataKi:  1.65E+4nMAssay Description:Displacement of 5-carboxyfluorescein-GpYDKPHVL-NH2 from mouse recombinant His-tagged STAT1-SH2 domain expressed in Escherichia coli BL21 (DE3) by flu...More data for this Ligand-Target Pair
In Depth
Date in BDB:
8/23/2011
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1(Mouse)
University of Toronto

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50556895BDBM50556895(CHEMBL4760561)
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1(Mouse)
University of Toronto

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 549118BDBM549118(BDBM50556884 | US11299480, Example 53)
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1(Mouse)
University of Toronto

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 549132BDBM549132(BDBM50556940 | US11299480, Example 138)
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1(Mouse)
University of Toronto

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 549125BDBM549125(US11299480, Example 135 | BDBM50556925)
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
In Depth
Date in BDB:
3/26/2022
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1(Mouse)
University of Toronto

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50353441BDBM50353441(CHEMBL1829786)
Affinity DataKi: >2.50E+4nMAssay Description:Inhibition of mouse STAT1 using fluorescent probe 5-carboxyfluorescein-GpYLPQTV-NH2 after 30 mins by fluorescence polarisation assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
3/24/2012
Entry Details Article
PubMed
TargetSignal transducer and activator of transcription 1(Mouse)
University of Toronto

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 20283BDBM20283(2-hydroxy-4-(2-{[(4-methylbenzene)sulfonyl]oxy}ace...)
Affinity DataIC50: 3.00E+5nMAssay Description:Inhibition of STAT1 dimerization in EGF-stimulated mouse NIH/3T3 cells overexpressing human EGFR assessed as suppression of STAT1-DNA interaction aft...More data for this Ligand-Target Pair
In Depth
Date in BDB:
5/17/2013
Entry Details Article
PubMed