BDBM496502 TAT-ENA-80bfd3e5-1
BDBM496503 TAT-ENA-80bfd3e5-4
BDBM496505 TAT-ENA-80bfd3e5-32
BDBM496508 TAT-ENA-80bfd3e5-42
TAT-ENA-80bfd3e5-36 BDBM496506
TAT-ENA-80bfd3e5-37 BDBM628223
TAT-ENA-80bfd3e5-45 BDBM496509
TAT-ENA-80bfd3e5-7 BDBM628220
CVD-0008041 TAT-ENA-80bfd3e5-7 BDBM496504
CVD-0018040 TAT-ENA-0e28ea53-1 BDBM495305
TAT-ENA-80bfd3e5-37 CVD-0008066 BDBM496507
BDBM93186 Src SH2 inhibitor, 1a
BDBM93190 Src SH2 inhibitor, 1e
BDBM93191 Src SH2 inhibitor, 1f
BDBM93192 Src SH2 inhibitor, 1g
BDBM93194 Src SH2 inhibitor, 3
BDBM93195 Src SH2 inhibitor, 4
Src SH2 inhibitor, 1b BDBM93187
Src SH2 inhibitor, 1c BDBM93188
Src SH2 inhibitor, 1d BDBM93189
Src SH2 inhibitor, 1h BDBM93193
- Wang, D; Iera, J; Baker, H; Hogan, P; Ptak, R; Yang, L; Hartman, T; Buckheit, RW; Desjardins, A; Yang, A; Legault, P; Yedavalli, V; Jeang, KT; Appella, DH Multivalent binding oligomers inhibit HIV Tat-TAR interaction critical for viral replication. Bioorg Med Chem Lett 19: 6893-7 (2009)
- Michne, WF; Schroeder, JD; Bailey, TR; Young, DC; Hughes, JV; Dutko, FJ Keto/enol epoxy steroids: a new structural class of HIV-1 Tat inhibitors. J Med Chem 36: 2701-2 (1993)
- XIE, Y; WU, Y; QIAN, L COMPOUNDS USED AS SRC INHIBITORS US Patent US20250042904 (2025)
- Michne, WF; Schroeder, JD; Bailey, TR; Neumann, HC; Cooke, D; Young, DC; Hughes, JV; Kingsley, SD; Ryan, KA; Putz, HS Keto/enol epoxy steroids as HIV-1 Tat inhibitors: structure-activity relationships and pharmacophore localization. J Med Chem 38: 3197-206 (1995)
- Nguyen, W; Jacobson, J; Jarman, KE; Jousset Sabroux, H; Harty, L; McMahon, J; Lewin, SR; Purcell, DF; Sleebs, BE Identification of 5-Substituted 2-Acylaminothiazoles That Activate Tat-Mediated Transcription in HIV-1 Latency Models. J Med Chem 62: 5148-5175 (2019)
- Small molecule inhibitors of SRC tyrosine kinase
- Ye, G; Ayrapetov, M; Nam, NH; Sun, G; Parang, K Solid-phase binding assays of peptides using EGFP-Src SH2 domain fusion protein and biotinylated Src SH2 domain. Bioorg Med Chem Lett 15: 4994-7 (2005)
- Bohacek, RS; Dalgarno, DC; Hatada, M; Jacobsen, VA; Lynch, BA; Macek, KJ; Merry, T; Metcalf, CA; Narula, SS; Sawyer, TK; Shakespeare, WC; Violette, SM; Weigele, M X-Ray structure of citrate bound to Src SH2 leads to a high-affinity, bone-targeted Src SH2 inhibitor. J Med Chem 44: 660-3 (2001)
- Deprez, P; Mandine, E; Vermond, A; Lesuisse, D Imidazole-based ligands of the Src SH2 protein. Bioorg Med Chem Lett 12: 1287-9 (2002)
- Lee, K; Kim, J; Jeong, KW; Lee, KW; Lee, Y; Song, JY; Kim, MS; Lee, GS; Kim, Y Structure-based virtual screening of Src kinase inhibitors. Bioorg Med Chem 17: 3152-61 (2009)
- Jagoe, CT; Kreifels, SE; Li, J Covalent binding of catechols to src family SH2 domains Bioorg Med Chem Lett 7: 113-116 (1997)
- Abbott, L; Betschmann, P; Burchat, A; Calderwood, DJ; Davis, H; Hrnciar, P; Hirst, GC; Li, B; Morytko, M; Mullen, K; Yang, B Discovery of thienopyridines as Src-family selective Lck inhibitors. Bioorg Med Chem Lett 17: 1167-71 (2007)
- Laurent, A; Rose, Y; Jaquith, JB Selective inhibitors of Tec and Src protein kinase families US Patent US9796716 (2017)
- Zhang, N; Wu, B; Boschelli, DH; Golas, JM; Boschelli, F 4-Anilino-7-pyridyl-3-quinolinecarbonitriles as Src kinase inhibitors. Bioorg Med Chem Lett 19: 5071-4 (2009)
- Sundaramoorthi, R; Shakespeare, WC; Keenan, TP; Metcalf, CA; Wang, Y; Mani, U; Taylor, M; Liu, S; Bohacek, RS; Narula, SS; Dalgarno, DC; van Schravandijk, MR; Violette, SM; Liou, S; Adams, S; Ram, MK; Keats, JA; Weigle, M; Sawyer, TK; Weigele, M Bone-targeted Src kinase inhibitors: novel pyrrolo- and pyrazolopyrimidine analogues. Bioorg Med Chem Lett 13: 3063-6 (2003)
- Schmidt, B; Jiricek, J; Titz, A; Ye, G; Parang, K Copper dipicolinates as peptidomimetic ligands for the Src SH2 domain. Bioorg Med Chem Lett 14: 4203-6 (2004)
- Nasrolahi Shirazi, A; Tiwari, RK; Brown, A; Mandal, D; Sun, G; Parang, K Cyclic peptides containing tryptophan and arginine as Src kinase inhibitors. Bioorg Med Chem Lett 23: 3230-4 (2013)
- Ko, KS; Steffey, ME; Brandvold, KR; Soellner, MB Development of a chimeric c-Src kinase and HDAC inhibitor. ACS Med Chem Lett 4: 779-783 (2013)
- Ju, T; Niu, W; Guo, J Evolution of Src Homology 2 (SH2) Domain to Recognize Sulfotyrosine. ACS Chem Biol 11: 2551-7 (2016)
- Fu, J; Lou, Y; He, Y Fused tricyclic ring derivatives as SRC homology-2 phosphatase inhibitors US Patent US10894797 (2021)
- Fu, J; Lou, Y; He, Y Fused tricyclic ring derivatives as Src homology-2 phosphate inhibitors US Patent US11034705 (2021)
- Boschelli, DH; Wang, D; Wang, Y; Wu, B; Honores, EE; Barrios Sosa, AC; Chaudhary, I; Golas, J; Lucas, J; Boschelli, F Optimization of 7-alkene-3-quinolinecarbonitriles as Src kinase inhibitors. Bioorg Med Chem Lett 20: 2924-7 (2010)
- Fu, J; Lou, Y; He, Y Tri-substituted heteroaryl derivatives as Src homology-2 phosphatase inhibitors US Patent US11459340 (2022)
- Berger, D; Dutia, M; Powell, D; Wu, B; Wissner, A; DeMorin, F; Weber, J; Boschelli, F 8-Anilinoimidazo[4,5-g]quinoline-7-carbonitriles as Src kinase inhibitors. Bioorg Med Chem Lett 12: 2761-5 (2002)
- Mc Allister, A; Murone, M; Sengupta, S; Shetty, SJ Bicyclic compounds and their uses as dual c-SRC/JAK inhibitors US Patent US8962637 (2015)
- Yasri, A; Cheve, G; Bories, C; Delon, L Derivatives of azaindoles as inhibitors of protein kinases ABL and SRC US Patent US8580815 (2013)
- Choi, WJ; Kim, SE; Stephen, AG; Weidlich, I; Giubellino, A; Liu, F; Worthy, KM; Bindu, L; Fivash, MJ; Nicklaus, MC; Bottaro, DP; Fisher, RJ; Burke, TR Identification of Shc Src homology 2 domain-binding peptoid-peptide hybrids. J Med Chem 52: 1612-8 (2009)
- Liu, Y; Bishop, A; Witucki, L; Kraybill, B; Shimizu, E; Tsien, J; Ubersax, J; Blethrow, J; Morgan, DO; Shokat, KM Structural basis for selective inhibition of Src family kinases by PP1. Chem Biol 6: 671-8 (1999)
- Buchanan, JL; Vu, CB; Merry, TJ; Corpuz, EG; Pradeepan, SG; Mani, UN; Yang, M; Plake, HR; Varkhedkar, VM; Lynch, BA; MacNeil, IA; Loiacono, KA; Tiong, CL; Holt, DA Structure-activity relationships of a novel class of Src SH2 inhibitors. Bioorg Med Chem Lett 9: 2359-64 (1999)
- Berger, D; Dutia, M; Powell, D; Wissner, A; DeMorin, F; Raifeld, Y; Weber, J; Boschelli, F Substituted 4-anilino-7-phenyl-3-quinolinecarbonitriles as Src kinase inhibitors. Bioorg Med Chem Lett 12: 2989-92 (2002)
- Puder, C; Wagner, K; Vettermann, R; Hauptmann, R; Potterat, O Terphenylquinone inhibitors of the src protein tyrosine kinase from Stilbella sp. J Nat Prod 68: 323-6 (2005)
- Lee, CW; Cao, H; Ichiyama, K; Rana, TM Design and synthesis of a novel peptidomimetic inhibitor of HIV-1 Tat-TAR interactions: squaryldiamide as a new potential bioisostere of unsubstituted guanidine. Bioorg Med Chem Lett 15: 4243-6 (2005)
- Pan, C; Mezei, M; Mujtaba, S; Muller, M; Zeng, L; Li, J; Wang, Z; Zhou, MM Structure-guided optimization of small molecules inhibiting human immunodeficiency virus 1 Tat association with the human coactivator p300/CREB binding protein-associated factor. J Med Chem 50: 2285-8 (2007)
- Guo, M; Dai, S; Wu, D; Duan, Y; Li, J; Qu, L; Jiang, L; Chen, Z; Chen, X; Chen, Y Characterization of ibrutinib as a non-covalent inhibitor of SRC-family kinases. Bioorg Med Chem Lett 34: (2021)
- Park, SH; Won, J; Lee, KH Design and characterization of non-phosphopeptide inhibitors for Src family SH2 domains. Bioorg Med Chem Lett 12: 2711-4 (2002)
- Plummer, MS; Holland, DR; Shahripour, A; Lunney, EA; Fergus, JH; Marks, JS; McConnell, P; Mueller, WT; Sawyer, TK Design, synthesis, and cocrystal structure of a nonpeptide Src SH2 domain ligand. J Med Chem 40: 3719-25 (1997)
- Zhang, G; Ren, P; Gray, NS; Sim, T; Wang, X; Liu, Y; Che, J; Dong, W; Tian, SS; Sandberg, ML; Spalding, TA; Romeo, R; Iskandar, M; Wang, Z; Seidel, HM; Karanewsky, DS; He, Y Discovery of pyrimidine benzimidazoles as Src-family selective Lck inhibitors. Part II. Bioorg Med Chem Lett 19: 6691-5 (2009)
- Boschelli, DH; Wang, DY; Ye, F; Yamashita, A; Zhang, N; Powell, D; Weber, J; Boschelli, F Inhibition of Src kinase activity by 4-anilino-7-thienyl-3-quinolinecarbonitriles. Bioorg Med Chem Lett 12: 2011-4 (2002)
- Wang, Y; Shakespeare, WC; Huang, WS; Sundaramoorthi, R; Lentini, S; Das, S; Liu, S; Banda, G; Wen, D; Zhu, X; Xu, Q; Keats, J; Wang, F; Wardwell, S; Ning, Y; Snodgrass, JT; Broudy, MI; Russian, K; Dalgarno, D; Clackson, T; Sawyer, TK Novel N9-arenethenyl purines as potent dual Src/Abl tyrosine kinase inhibitors. Bioorg Med Chem Lett 18: 4907-12 (2008)
- Chu, JJ; Yang, PL c-Src protein kinase inhibitors block assembly and maturation of dengue virus. Proc Natl Acad Sci U S A 104: 3520-5 (2007)
- Berger, DM; Dutia, M; Birnberg, G; Powell, D; Boschelli, DH; Wang, YD; Ravi, M; Yaczko, D; Golas, J; Lucas, J; Boschelli, F 4-Anilino-7,8-dialkoxybenzo[g]quinoline-3-carbonitriles as potent Src kinase inhibitors. J Med Chem 48: 5909-20 (2005)
- Kohlmann, A; Zhu, X; Dalgarno, D Application of MM-GB/SA and WaterMap to SRC Kinase Inhibitor Potency Prediction. ACS Med Chem Lett 3: 94-99 (2012)
- Deng, L; Mo, J; Zhang, Y; Peng, K; Li, H; Ouyang, S; Feng, Z; Fang, W; Wei, J; Rong, D; Zhang, X; Wang, Y Boronic Acid: A Novel Pharmacophore Targeting Src Homology 2 (SH2) Domain of STAT3. J Med Chem 65: 13094-13111 (2022)
- Lesuisse, D; Deprez, P; Albert, E; Duc, TT; Sortais, B; Gofflo, D; Jean-Baptiste, V; Marquette, J; Schoot, B; Sarubbi, E; Lange, G; Broto, P; Mandine, E Discovery of thioazepinone ligands for Src SH2: from non-specific to specific binding. Bioorg Med Chem Lett 11: 2127-31 (2001)
- Sperl, B; Seifert, MH; Berg, T Natural product inhibitors of protein-protein interactions mediated by Src-family SH2 domains. Bioorg Med Chem Lett 19: 3305-9 (2009)
- Boschelli, DH; Ye, F; Wang, YD; Dutia, M; Johnson, SL; Wu, B; Miller, K; Powell, DW; Yaczko, D; Young, M; Tischler, M; Arndt, K; Discafani, C; Etienne, C; Gibbons, J; Grod, J; Lucas, J; Weber, JM; Boschelli, F Optimization of 4-phenylamino-3-quinolinecarbonitriles as potent inhibitors of Src kinase activity. J Med Chem 44: 3965-77 (2001)
- Deprez, P; Mandine, E; Gofflo, D; Meunier, S; Lesuisse, D Small ligands interacting with the phosphotyrosine binding pocket of the Src SH2 protein. Bioorg Med Chem Lett 12: 1295-8 (2002)
- Buchanan, JL; Bohacek, RS; Luke, GP; Hatada, M; Lu, X; Dalgarno, DC; Narula, SS; Yuan, R; Holt, DA Structure-based design and synthesis of a novel class of Src SH2 inhibitors. Bioorg Med Chem Lett 9: 2353-8 (1999)
- Shakespeare, WC; Bohacek, RS; Azimioara, MD; Macek, KJ; Luke, GP; Dalgarno, DC; Hatada, MH; Lu, X; Violette, SM; Bartlett, C; Sawyer, TK Structure-based design of novel bicyclic nonpeptide inhibitors for the src SH2 domain. J Med Chem 43: 3815-9 (2000)
- Deprez, P; Baholet, I; Burlet, S; Lange, G; Amengual, R; Schoot, B; Vermond, A; Mandine, E; Lesuisse, D Discovery of highly potent Src SH2 binders: structure-activity studies and X-ray structures. Bioorg Med Chem Lett 12: 1291-4 (2002)
- Radi, M; Brullo, C; Crespan, E; Tintori, C; Musumeci, F; Biava, M; Schenone, S; Dreassi, E; Zamperini, C; Maga, G; Pagano, D; Angelucci, A; Bologna, M; Botta, M Identification of potent c-Src inhibitors strongly affecting the proliferation of human neuroblastoma cells. Bioorg Med Chem Lett 21: 5928-33 (2011)
- Boschelli, DH; Powell, D; Golas, JM; Boschelli, F Inhibition of Src kinase activity by 4-anilino-5,10-dihydro-pyrimido[4,5-b]quinolines. Bioorg Med Chem Lett 13: 2977-80 (2003)
- Missbach, M; Altmann, E; Widler, L; Susa, M; Buchdunger, E; Mett, H; Meyer, T; Green, J Substituted 5,7-diphenyl-pyrrolo[2,3d]pyrimidines: potent inhibitors of the tyrosine kinase c-Src. Bioorg Med Chem Lett 10: 945-9 (2000)
- Boschelli, DH; Wang, YD; Ye, F; Wu, B; Zhang, N; Dutia, M; Powell, DW; Wissner, A; Arndt, K; Weber, JM; Boschelli, F Synthesis and Src kinase inhibitory activity of a series of 4-phenylamino-3-quinolinecarbonitriles. J Med Chem 44: 822-33 (2001)
- Rao, VK; Chhikara, BS; Shirazi, AN; Tiwari, R; Parang, K; Kumar, A 3-substitued indoles: one-pot synthesis and evaluation of anticancer and Src kinase inhibitory activities. Bioorg Med Chem Lett 21: 3511-4 (2011)
- Boschelli, DH; Wang, YD; Johnson, S; Wu, B; Ye, F; Barrios Sosa, AC; Golas, JM; Boschelli, F 7-Alkoxy-4-phenylamino-3-quinolinecar-bonitriles as dual inhibitors of Src and Abl kinases. J Med Chem 47: 1599-601 (2004)
- Design and synthesis of dual BRD4/Src inhibitors for treatment of triple-negative breast cancer.
- Chen, P; Norris, D; Iwanowicz, EJ; Spergel, SH; Lin, J; Gu, HH; Shen, Z; Wityak, J; Lin, TA; Pang, S; De Fex, HF; Pitt, S; Shen, DR; Doweyko, AM; Bassolino, DA; Roberge, JY; Poss, MA; Chen, BC; Schieven, GL; Barrish, JC Discovery and initial SAR of imidazoquinoxalines as inhibitors of the Src-family kinase p56(Lck). Bioorg Med Chem Lett 12: 1361-4 (2002)
- Noronha, G; Barrett, K; Cao, J; Dneprovskaia, E; Fine, R; Gong, X; Gritzen, C; Hood, J; Kang, X; Klebansky, B; Li, G; Liao, W; Lohse, D; Mak, CC; McPherson, A; Palanki, MS; Pathak, VP; Renick, J; Soll, R; Splittgerber, U; Wrasidlo, W; Zeng, B; Zhao, N; Zhou, Y Discovery and preliminary structure-activity relationship studies of novel benzotriazine based compounds as Src inhibitors. Bioorg Med Chem Lett 16: 5546-50 (2006)
- Tintori, C; Magnani, M; Schenone, S; Botta, M Docking, 3D-QSAR studies and in silico ADME prediction on c-Src tyrosine kinase inhibitors. Eur J Med Chem 44: 990-1000 (2009)
- Mukaiyama, H; Nishimura, T; Kobayashi, S; Komatsu, Y; Kikuchi, S; Ozawa, T; Kamada, N; Ohnota, H Novel pyrazolo[1,5-a]pyrimidines as c-Src kinase inhibitors that reduce IKr channel blockade. Bioorg Med Chem 16: 909-21 (2008)
- Shahripour, A; Para, KS; Plummer, MS; Lunney, EA; Holland, DR; Rubin, JR; Humblet, C; Fergus, JH; Marks, JS; Saltiel, AR; Sawyer, TK Structure-based design of novel, dipeptide ligands targeting the pp60Src SH2 domain Bioorg Med Chem Lett 7: 1107-1112 (1997)
- Chand, K; Prasad, S; Tiwari, RK; Shirazi, AN; Kumar, S; Parang, K; Sharma, SK Synthesis and evaluation of c-Src kinase inhibitory activity of pyridin-2(1H)-one derivatives. Bioorg Chem 53: 75-82 (2014)
- Pevet, I; Brulé, C; Tizot, A; Gohier, A; Cruzalegui, F; Boutin, JA; Goldstein, S Synthesis and pharmacological evaluation of thieno[2,3-b]pyridine derivatives as novel c-Src inhibitors. Bioorg Med Chem 19: 2517-28 (2011)
- Wang, YD; Bao, XQ; Xu, S; Yu, WW; Cao, SN; Hu, JP; Li, Y; Wang, XL; Zhang, D; Yu, SS A Novel Parkinson's Disease Drug Candidate with Potent Anti-neuroinflammatory Effects through the Src Signaling Pathway. J Med Chem 59: 9062-9079 (2016)
- Kraker, AJ; Hartl, BG; Amar, AM; Barvian, MR; Showalter, HD; Moore, CW Biochemical and cellular effects of c-Src kinase-selective pyrido[2,3-d]pyrimidine tyrosine kinase inhibitors. Biochem Pharmacol 60: 885-98 (2000)
- Huang, H; Ma, J; Shi, J; Meng, L; Jiang, H; Ding, J; Liu, H Discovery of novel purine derivatives with potent and selective inhibitory activity against c-Src tyrosine kinase. Bioorg Med Chem 18: 4615-24 (2011)
- Molinari, A; Fallacara, AL; Di Maria, S; Zamperini, C; Poggialini, F; Musumeci, F; Schenone, S; Angelucci, A; Colapietro, A; Crespan, E; Kissova, M; Maga, G; Botta, M Efficient optimization of pyrazolo[3,4-d]pyrimidines derivatives as c-Src kinase inhibitors in neuroblastoma treatment. Bioorg Med Chem Lett 28: 3454-3457 (2018)
- Boschelli, DH; Barrios Sosa, AC; Golas, JM; Boschelli, F Inhibition of Src kinase activity by 7-ethynyl-4-phenylamino-3-quinolinecarbonitriles: identification of SKS-927. Bioorg Med Chem Lett 17: 1358-61 (2007)
- Lawrence, HR; Pireddu, R; Chen, L; Luo, Y; Sung, SS; Szymanski, AM; Yip, ML; Guida, WC; Sebti, SM; Wu, J; Lawrence, NJ Inhibitors of Src homology-2 domain containing protein tyrosine phosphatase-2 (Shp2) based on oxindole scaffolds. J Med Chem 51: 4948-56 (2008)
- Shahripour, A; Plummer, MS; Lunney, EA; Para, KS; Stankovic, CJ; Rubin, JR; Humblet, C; Fergus, JH; Marks, JS; Herrera, R; Hubbell, SE; Saltiel, AR; Sawyer, TK Novel phosphotyrosine mimetics in the design of peptide ligands for pp60src SH2 domain Bioorg Med Chem Lett 6: 1209-1214 (1996)
- Rao, VK; Chhikara, BS; Tiwari, R; Shirazi, AN; Parang, K; Kumar, A One-pot regioselective synthesis of tetrahydroindazolones and evaluation of their antiproliferative and Src kinase inhibitory activities. Bioorg Med Chem Lett 22: 410-4 (2011)
- Vignaroli, G; Zamperini, C; Dreassi, E; Radi, M; Angelucci, A; Sanità, P; Crespan, E; Kissova, M; Maga, G; Schenone, S; Musumeci, F; Botta, M Pyrazolo[3,4-d]pyrimidine Prodrugs: Strategic Optimization of the Aqueous Solubility of Dual Src/Abl Inhibitors. ACS Med Chem Lett 4: 622-6 (2013)
- Hu, X; Dang, Y; Tenney, K; Crews, P; Tsai, CW; Sixt, KM; Cole, PA; Liu, JO Regulation of c-Src nonreceptor tyrosine kinase activity by bengamide A through inhibition of methionine aminopeptidases. Chem Biol 14: 764-74 (2007)
- Bobone, S; Pannone, L; Biondi, B; Solman, M; Flex, E; Canale, VC; Calligari, P; De Faveri, C; Gandini, T; Quercioli, A; Torini, G; Venditti, M; Lauri, A; Fasano, G; Hoeksma, J; Santucci, V; Cattani, G; Bocedi, A; Carpentieri, G; Tirelli, V; Sanchez, M; Peggion, C; Formaggio, F; den Hertog, J; Martinelli, S; Bocchinfuso, G; Tartaglia, M; Stella, L Targeting Oncogenic Src Homology 2 Domain-Containing Phosphatase 2 (SHP2) by Inhibiting Its Protein-Protein Interactions. J Med Chem 64: 15973-15990 (2021)
- Wang, Y; Metcalf, CA; Shakespeare, WC; Sundaramoorthi, R; Keenan, TP; Bohacek, RS; van Schravendijk, MR; Violette, SM; Narula, SS; Dalgarno, DC; Haraldson, C; Keats, J; Liou, S; Mani, U; Pradeepan, S; Ram, M; Adams, S; Weigele, M; Sawyer, TK Bone-targeted 2,6,9-trisubstituted purines: novel inhibitors of Src tyrosine kinase for the treatment of bone diseases. Bioorg Med Chem Lett 13: 3067-70 (2003)
- Kumar, D; Reddy, VB; Kumar, A; Mandal, D; Tiwari, R; Parang, K Click chemistry inspired one-pot synthesis of 1,4-disubstituted 1,2,3-triazoles and their Src kinase inhibitory activity. Bioorg Med Chem Lett 21: 449-52 (2010)
- Price, DJ; Jorgensen, WL Computational binding studies of human pp60c-src SH2 domain with a series of nonpeptide, phosphophenyl-containing ligands. Bioorg Med Chem Lett 10: 2067-70 (2000)
- Nam, NH; Ye, G; Sun, G; Parang, K Conformationally constrained peptide analogues of pTyr-Glu-Glu-Ile as inhibitors of the Src SH2 domain binding. J Med Chem 47: 3131-41 (2004)
- Huang, H; Jia, Q; Ma, J; Qin, G; Chen, Y; Xi, Y; Lin, L; Zhu, W; Ding, J; Jiang, H; Liu, H Discovering novel quercetin-3-O-amino acid-esters as a new class of Src tyrosine kinase inhibitors. Eur J Med Chem 44: 1982-8 (2009)
- Burchat, A; Borhani, DW; Calderwood, DJ; Hirst, GC; Li, B; Stachlewitz, RF Discovery of A-770041, a src-family selective orally active lck inhibitor that prevents organ allograft rejection. Bioorg Med Chem Lett 16: 118-22 (2005)
- Barrios Sosa, AC; Boschelli, DH; Wu, B; Wang, Y; Golas, JM Further studies on ethenyl and ethynyl-4-phenylamino-3-quinolinecarbonitriles: identification of a subnanomolar Src kinase inhibitor. Bioorg Med Chem Lett 15: 1743-7 (2005)
- Zhang, Z; Zeng, L Hydroxyindole carboxylic acid based inhibitors for oncogenic Src homology-2 domain containing protein tyrosine phosphatase-2 (SHP2) US Patent US9522881 (2016)
- Boschelli, DH; Wu, B; Barrios Sosa, AC; Durutlic, H; Ye, F; Raifeld, Y; Golas, JM; Boschelli, F Identification of 7-phenylaminothieno- [3,2-b]pyridine-6-carbonitriles as a new class of Src kinase inhibitors. J Med Chem 47: 6666-8 (2004)
- Musumeci, F; Fallacara, AL; Brullo, C; Grossi, G; Botta, L; Calandro, P; Chiariello, M; Kissova, M; Crespan, E; Maga, G; Schenone, S Identification of new pyrrolo[2,3-d]pyrimidines as Src tyrosine kinase inhibitors in vitro active against Glioblastoma. Eur J Med Chem 127: 369-378 (2017)
- Lin, LG; Xie, H; Li, HL; Tong, LJ; Tang, CP; Ke, CQ; Liu, QF; Lin, LP; Geng, MY; Jiang, H; Zhao, WM; Ding, J; Ye, Y Naturally occurring homoisoflavonoids function as potent protein tyrosine kinase inhibitors by c-Src-based high-throughput screening. J Med Chem 51: 4419-29 (2008)
- Lin, J; Shen, W; Xue, J; Sun, J; Zhang, X; Zhang, C Novel oxazolo[4,5-g]quinazolin-2(1H)-ones: dual inhibitors of EGFR and Src protein tyrosine kinases. Eur J Med Chem 55: 39-48 (2012)
- Barrios Sosa, AC; Boschelli, DH; Ye, F; Golas, JM; Boschelli, F Synthesis and inhibition of Src kinase activity by 7-ethenyl and 7-ethynyl-4-anilino-3-quinolinecarbonitriles. Bioorg Med Chem Lett 14: 2155-8 (2004)
- Kumar, A; Ahmad, I; Chhikara, BS; Tiwari, R; Mandal, D; Parang, K Synthesis of 3-phenylpyrazolopyrimidine-1,2,3-triazole conjugates and evaluation of their Src kinase inhibitory and anticancer activities. Bioorg Med Chem Lett 21: 1342-6 (2011)
- Huang, WS; Zhu, X; Wang, Y; Azam, M; Wen, D; Sundaramoorthi, R; Thomas, RM; Liu, S; Banda, G; Lentini, SP; Das, S; Xu, Q; Keats, J; Wang, F; Wardwell, S; Ning, Y; Snodgrass, JT; Broudy, MI; Russian, K; Daley, GQ; Iuliucci, J; Dalgarno, DC; Clackson, T; Sawyer, TK; Shakespeare, WC 9-(Arenethenyl)purines as dual Src/Abl kinase inhibitors targeting the inactive conformation: design, synthesis, and biological evaluation. J Med Chem 52: 4743-56 (2009)
- Manetti, F; Locatelli, GA; Maga, G; Schenone, S; Modugno, M; Forli, S; Corelli, F; Botta, M A combination of docking/dynamics simulations and pharmacophoric modeling to discover new dual c-Src/Abl kinase inhibitors. J Med Chem 49: 3278-86 (2006)
- Vu, CB; Luke, GP; Kawahata, N; Shakespeare, WC; Wang, Y; Sundaramoorthi, R; Metcalf, CA; Keenan, TP; Pradeepan, S; Corpuz, E; Merry, T; Bohacek, RS; Dalgarno, DC; Narula, SS; van Schravendijk, MR; Ram, MK; Adams, S; Liou, S; Keats, JA; Violette, SM; Guan, W; Weigele, M; Sawyer, TK Bone-targeted pyrido[2,3-d]pyrimidin-7-ones: potent inhibitors of Src tyrosine kinase as novel antiresorptive agents. Bioorg Med Chem Lett 13: 3071-4 (2003)
- Wityak, J; Das, J; Moquin, RV; Shen, Z; Lin, J; Chen, P; Doweyko, AM; Pitt, S; Pang, S; Shen, DR; Fang, Q; de Fex, HF; Schieven, GL; Kanner, SB; Barrish, JC Discovery and initial SAR of 2-amino-5-carboxamidothiazoles as inhibitors of the Src-family kinase p56(Lck). Bioorg Med Chem Lett 13: 4007-10 (2003)
- Smolinski, MP; Bu, Y; Clements, J; Gelman, IH; Hegab, T; Cutler, DL; Fang, JWS; Fetterly, G; Kwan, R; Barnett, A; Lau, JYN; Hangauer, DG Discovery of Novel Dual Mechanism of Action Src Signaling and Tubulin Polymerization Inhibitors (KX2-391 and KX2-361). J Med Chem 61: 4704-4719 (2018)
- Schmidt, S; Preu, L; Lemcke, T; Totzke, F; Schächtele, C; Kubbutat, MH; Kunick, C Dual IGF-1R/SRC inhibitors based on a N'-aroyl-2-(1H-indol-3-yl)-2-oxoacetohydrazide structure. Eur J Med Chem 46: 2759-69 (2011)
- Crespan, E; Radi, M; Zanoli, S; Schenone, S; Botta, M; Maga, G Dual Src and Abl inhibitors target wild type Abl and the AblT315I Imatinib-resistant mutant with different mechanisms. Bioorg Med Chem 18: 3999-4008 (2010)
- Barlaam, B; Fennell, M; Germain, H; Green, T; Hennequin, L; Morgentin, R; Olivier, A; Plé, P; Vautier, M; Costello, G New heterocyclic analogues of 4-(2-chloro-5-methoxyanilino)quinazolines as potent and selective c-Src kinase inhibitors. Bioorg Med Chem Lett 15: 5446-9 (2005)
- Zhou, T; Commodore, L; Huang, WS; Wang, Y; Sawyer, TK; Shakespeare, WC; Clackson, T; Zhu, X; Dalgarno, DC Structural analysis of DFG-in and DFG-out dual Src-Abl inhibitors sharing a common vinyl purine template. Chem Biol Drug Des 75: 18-28 (2010)
- Wu, B; Barrios Sosa, AC; Boschelli, DH; Boschelli, F; Honores, EE; Golas, JM; Powell, DW; Wang, YD 7-(aryl/heteroaryl-2-ylethynyl)-4-phenylamino-3-quinolinecarbonitriles as new Src kinase inhibitors: addition of water solubilizing groups. Bioorg Med Chem Lett 16: 3993-7 (2006)
- Widler, L; Green, J; Missbach, M; Susa, M; Altmann, E 7-Alkyl- and 7-cycloalkyl-5-aryl-pyrrolo[2,3-d]pyrimidines--potent inhibitors of the tyrosine kinase c-Src. Bioorg Med Chem Lett 11: 849-52 (2001)
- Altmann, E; Missbach, M; Green, J; Susa, M; Wagenknecht, HA; Widler, L 7-Pyrrolidinyl- and 7-piperidinyl-5-aryl-pyrrolo[2,3-d]pyrimidines--potent inhibitors of the tyrosine kinase c-Src. Bioorg Med Chem Lett 11: 853-6 (2001)
- Chen, P; Norris, D; Das, J; Spergel, SH; Wityak, J; Leith, L; Zhao, R; Chen, BC; Pitt, S; Pang, S; Shen, DR; Zhang, R; De Fex, HF; Doweyko, AM; McIntyre, KW; Shuster, DJ; Behnia, K; Schieven, GL; Barrish, JC Discovery of novel 2-(aminoheteroaryl)-thiazole-5-carboxamides as potent and orally active Src-family kinase p56(Lck) inhibitors. Bioorg Med Chem Lett 14: 6061-6 (2004)
- Wang, YD; Miller, K; Boschelli, DH; Ye, F; Wu, B; Floyd, MB; Powell, DW; Wissner, A; Weber, JM; Boschelli, F Inhibitors of src tyrosine kinase: the preparation and structure-activity relationship of 4-anilino-3-cyanoquinolines and 4-anilinoquinazolines. Bioorg Med Chem Lett 10: 2477-80 (2000)
- Ye, B; Akamatsu, M; Shoelson, SE; Wolf, G; Giorgetti-Peraldi, S; Yan, X; Roller, PP; Burke, TR L-O-(2-malonyl)tyrosine: a new phosphotyrosyl mimetic for the preparation of Src homology 2 domain inhibitory peptides. J Med Chem 38: 4270-5 (1995)
- Zhang, X; He, Y; Liu, S; Yu, Z; Jiang, ZX; Yang, Z; Dong, Y; Nabinger, SC; Wu, L; Gunawan, AM; Wang, L; Chan, RJ; Zhang, ZY Salicylic acid based small molecule inhibitor for the oncogenic Src homology-2 domain containing protein tyrosine phosphatase-2 (SHP2). J Med Chem 53: 2482-93 (2010)
- Dalgarno, D; Stehle, T; Narula, S; Schelling, P; van Schravendijk, MR; Adams, S; Andrade, L; Keats, J; Ram, M; Jin, L; Grossman, T; MacNeil, I; Metcalf, C; Shakespeare, W; Wang, Y; Keenan, T; Sundaramoorthi, R; Bohacek, R; Weigele, M; Sawyer, T Structural basis of Src tyrosine kinase inhibition with a new class of potent and selective trisubstituted purine-based compounds. Chem Biol Drug Des 67: 46-57 (2006)
- Du, G; Rao, S; Gurbani, D; Henning, NJ; Jiang, J; Che, J; Yang, A; Ficarro, SB; Marto, JA; Aguirre, AJ; Sorger, PK; Westover, KD; Zhang, T; Gray, NS Structure-Based Design of a Potent and Selective Covalent Inhibitor for SRC Kinase That Targets a P-Loop Cysteine. J Med Chem 63: 1624-1641 (2020)
- Boschelli, DH; Wu, B; Barrios Sosa, AC; Durutlic, H; Chen, JJ; Wang, Y; Golas, JM; Lucas, J; Boschelli, F Synthesis and Src kinase inhibitory activity of 2-phenyl- and 2-thienyl-7-phenylaminothieno[3,2-b]pyridine-6-carbonitriles. J Med Chem 48: 3891-902 (2005)
- Kumar, A; Ye, G; Wang, Y; Lin, X; Sun, G; Parang, K Synthesis and structure-activity relationships of linear and conformationally constrained peptide analogues of CIYKYY as Src tyrosine kinase inhibitors. J Med Chem 49: 3395-401 (2006)
- Gifford, SM; Liu, W; Mader, CC; Halo, TL; Machida, K; Boggon, TJ; Koleske, AJ Two amino acid residues confer different binding affinities of Abelson family kinase SRC homology 2 domains for phosphorylated cortactin. J Biol Chem 289: 19704-13 (2014)
- Luan, X; Gao, C; Zhang, N; Chen, Y; Sun, Q; Tan, C; Liu, H; Jin, Y; Jiang, Y Exploration of acridine scaffold as a potentially interesting scaffold for discovering novel multi-target VEGFR-2 and Src kinase inhibitors. Bioorg Med Chem 19: 3312-9 (2011)
- Boschelli, DH; Wu, B; Barrios Sosa, AC; Chen, JJ; Golas, JM; Boschelli, F Inhibition of Src kinase activity by 7-[(2,4-dichloro-5-methoxyphenyl)amino]-2-heteroaryl-thieno[3,2-b]pyridine-6-carbonitriles. Bioorg Med Chem Lett 15: 4681-4 (2005)
- Metcalf, CA; Eyermann, CJ; Bohacek, RS; Haraldson, CA; Varkhedkar, VM; Lynch, BA; Bartlett, C; Violette, SM; Sawyer, TK Structure-based design and solid-phase parallel synthesis of phosphorylated nonpeptides to explore hydrophobic binding at the Src SH2 domain. J Comb Chem 2: 305-13 (2000)
- Boschelli, DH; Wu, B; Ye, F; Wang, Y; Golas, JM; Lucas, J; Boschelli, F Synthesis and Src kinase inhibitory activity of a series of 4-[(2,4-dichloro-5-methoxyphenyl)amino]-7-furyl-3-quinolinecarbonitriles. J Med Chem 49: 7868-76 (2006)
- Dincer, S; Cetin, KT; Onay-Besikci, A; Ölgen, S Synthesis, biological evaluation and docking studies of new pyrrolo[2,3-d] pyrimidine derivatives as Src family-selective tyrosine kinase inhibitors. J Enzyme Inhib Med Chem 28: 1080-7 (2013)
- Marsilje, TH; Milkiewicz, KL; Hangauer, DG The design, synthesis and activity of non-ATP competitive inhibitors of pp60(c-src) tyrosine kinase. Part 1: hydroxynaphthalene derivatives. Bioorg Med Chem Lett 10: 477-81 (2000)
- Milkiewicz, KL; Marsilje, TH; Woodworth, RP; Bifulco, N; Hangauer, MJ; Hangauer, DG The design, synthesis and activity of non-ATP competitive inhibitors of pp60(c-src) tyrosine kinase. Part 2: hydroxyindole derivatives. Bioorg Med Chem Lett 10: 483-6 (2000)
- Kawahata, N; Yang, MG; Luke, GP; Shakespeare, WC; Sundaramoorthi, R; Wang, Y; Johnson, D; Merry, T; Violette, S; Guan, W; Bartlett, C; Smith, J; Hatada, M; Lu, X; Dalgarno, DC; Eyermann, CJ; Bohacek, RS; Sawyer, TK A novel phosphotyrosine mimetic 4'-carboxymethyloxy-3'-phosphonophenylalanine (Cpp): exploitation in the design of nonpeptide inhibitors of pp60(Src) SH2 domain. Bioorg Med Chem Lett 11: 2319-23 (2001)
- Wang, WL; Chen, XY; Gao, Y; Gao, LX; Sheng, L; Zhu, J; Xu, L; Ding, ZZ; Zhang, C; Li, JY; Li, J; Zhou, YB Benzo[c][1,2,5]thiadiazole derivatives: A new class of potent Src homology-2 domain containing protein tyrosine phosphatase-2 (SHP2) inhibitors. Bioorg Med Chem Lett 27: 5154-5157 (2017)
- Cao, X; You, QD; Li, ZY; Guo, QL; Shang, J; Yan, M; Chern, JW; Chen, ML Design and synthesis of 7-alkoxy-4-heteroarylamino-3-quinolinecarbonitriles as dual inhibitors of c-Src kinase and nitric oxide synthase. Bioorg Med Chem 16: 5890-8 (2008)
- Guan, H; Laird, AD; Blake, RA; Tang, C; Liang, C Design and synthesis of aminopropyl tetrahydroindole-based indolin-2-ones as selective and potent inhibitors of Src and Yes tyrosine kinase. Bioorg Med Chem Lett 14: 187-90 (2003)
- Ple, PA; Green, TP; Hennequin, LF; Curwen, J; Fennell, M; Allen, J; Lambert-Van Der Brempt, C; Costello, G Discovery of a new class of anilinoquinazoline inhibitors with high affinity and specificity for the tyrosine kinase domain of c-Src. J Med Chem 47: 871-87 (2004)
- Sharma, RK; Singh, S; Tiwari, R; Mandal, D; Olsen, CE; Parmar, VS; Parang, K; Prasad, AK O-Aryla,ß-d-ribofuranosides: synthesis& highly efficient biocatalytic separation of anomers and evaluation of their Src kinase inhibitory activity. Bioorg Med Chem 20: 6821-30 (2012)
- Dow, RL; Bechle, BM; Chou, TT; Goddard, C; Larson, ER Selective inhibition of the tyrosine kinase pp60src by analogs of 5,10-dihydropyrimido[4,5-b]quinolin-4(1H)-one Bioorg Med Chem Lett 5: 1007-1010 (1995)
- Cushman, M; Zhu, H; Geahlen, RL; Kraker, AJ Synthesis and biochemical evaluation of a series of aminoflavones as potential inhibitors of protein-tyrosine kinases p56lck, EGFr, and p60v-src. J Med Chem 37: 3353-62 (1994)
- Mukaiyama, H; Nishimura, T; Kobayashi, S; Ozawa, T; Kamada, N; Komatsu, Y; Kikuchi, S; Oonota, H; Kusama, H Synthesis and c-Src inhibitory activity of imidazo[1,5-a]pyrazine derivatives as an agent for treatment of acute ischemic stroke. Bioorg Med Chem 15: 868-85 (2006)
- Cao, X; You, QD; Li, ZY; Liu, XR; Xu, D; Guo, QL; Shang, J; Chern, JW; Chen, ML The design, synthesis and biological evaluation of 7-alkoxy-4-heteroarylamino-3-cyanoquinolines as dual inhibitors of c-Src and iNOS. Bioorg Med Chem Lett 18: 6206-9 (2008)
- Chu, CY; Chang, CP; Chou, YT; Handoko, na; Hu, YL; Lo, LC; Lin, JJ Development and evaluation of novel phosphotyrosine mimetic inhibitors targeting the Src homology 2 domain of signaling lymphocytic activation molecule (SLAM) associated protein. J Med Chem 56: 2841-9 (2013)
- Orcajo-Rincón, L; Ortega-Gutiérrez, S; Serrano, P; Torrecillas, IR; Wüthrich, K; Campillo, M; Pardo, L; Viso, A; Benhamú, B; López-Rodríguez, ML Development of non-peptide ligands of growth factor receptor-bound protein 2-SRC homology 2 domain using molecular modeling and NMR spectroscopy. J Med Chem 54: 1096-100 (2011)
- Olgen, S; Akaho, E; Nebioglu, D Evaluation of indole esters as inhibitors of p60(c-Src) receptor tyrosine kinase and investigation of the inhibition using receptor docking studies. J Enzyme Inhib Med Chem 18: 485-90 (2003)
- Taylor, JD; Gilbert, PJ; Williams, MA; Pitt, WR; Ladbury, JE Identification of novel fragment compounds targeted against the pY pocket of v-Src SH2 by computational and NMR screening and thermodynamic evaluation. Proteins 67: 981-90 (2007)
- Mandal, PK; Gao, F; Lu, Z; Ren, Z; Ramesh, R; Birtwistle, JS; Kaluarachchi, KK; Chen, X; Bast, RC; Liao, WS; McMurray, JS Potent and selective phosphopeptide mimetic prodrugs targeted to the Src homology 2 (SH2) domain of signal transducer and activator of transcription 3. J Med Chem 54: 3549-63 (2011)
- Lange, G; Lesuisse, D; Deprez, P; Schoot, B; Loenze, P; Bénard, D; Marquette, JP; Broto, P; Sarubbi, E; Mandine, E Principles governing the binding of a class of non-peptidic inhibitors to the SH2 domain of src studied by X-ray analysis. J Med Chem 45: 2915-22 (2002)
- Satheeshkumar, R; Zhu, R; Feng, B; Huang, C; Gao, Y; Gao, LX; Shen, C; Hou, TJ; Xu, L; Li, J; Zhu, YL; Zhou, YB; Wang, WL Synthesis and biological evaluation of heterocyclic bis-aryl amides as novel Src homology 2 domain containing protein tyrosine phosphatase-2 (SHP2) inhibitors. Bioorg Med Chem Lett 30: (2020)
- Liu, M; Gao, S; Liang, T; Qiu, X; Yang, X; Fang, H; Hou, X Discovery of Novel Src Homology-2 Domain-Containing Phosphatase 2 and Histone Deacetylase Dual Inhibitors with Potent Antitumor Efficacy and Enhanced Antitumor Immunity. J Med Chem 65: 12200-12218 (2022)
- Boschelli, DH; Ye, F; Wu, B; Wang, YD; Barrios Sosa, AC; Yaczko, D; Powell, D; Golas, JM; Lucas, J; Boschelli, F Investigation of the effect of varying the 4-anilino and 7-alkoxy groups of 3-quinolinecarbonitriles on the inhibition of Src kinase activity. Bioorg Med Chem Lett 13: 3797-800 (2003)
- El-Moghazy, SM; George, RF; Osman, EEA; Elbatrawy, AA; Kissova, M; Colombo, A; Crespan, E; Maga, G Novel pyrazolo[3,4-d]pyrimidines as dual Src-Abl inhibitors active against mutant form of Abl and the leukemia K-562 cell line. Eur J Med Chem 123: 1-13 (2016)
- Sundaramoorthi, R; Siedem, C; Vu, CB; Dalgarno, DC; Laird, EC; Botfield, MC; Combs, AB; Adams, SE; Yuan, RW; Weigele, M; Narula, SS Selective inhibition of Src SH2 by a novel thiol-targeting tricarbonyl-modified inhibitor and mechanistic analysis by (1)H/(13)C NMR spectroscopy. Bioorg Med Chem Lett 11: 1665-9 (2001)
- Page, BD; Croucher, DC; Li, ZH; Haftchenary, S; Jimenez-Zepeda, VH; Atkinson, J; Spagnuolo, PA; Wong, YL; Colaguori, R; Lewis, AM; Schimmer, AD; Trudel, S; Gunning, PT Inhibiting aberrant signal transducer and activator of transcription protein activation with tetrapodal, small molecule Src homology 2 domain binders: promising agents against multiple myeloma. J Med Chem 56: 7190-200 (2013)
- Carraro, F; Naldini, A; Pucci, A; Locatelli, GA; Maga, G; Schenone, S; Bruno, O; Ranise, A; Bondavalli, F; Brullo, C; Fossa, P; Menozzi, G; Mosti, L; Modugno, M; Tintori, C; Manetti, F; Botta, M Pyrazolo[3,4-d]pyrimidines as potent antiproliferative and proapoptotic agents toward A431 and 8701-BC cells in culture via inhibition of c-Src phosphorylation. J Med Chem 49: 1549-61 (2006)
- Thompson, AM; Rewcastle, GW; Boushelle, SL; Hartl, BG; Kraker, AJ; Lu, GH; Batley, BL; Panek, RL; Showalter, HD; Denny, WA Synthesis and structure-activity relationships of 7-substituted 3-(2, 6-dichlorophenyl)-1,6-naphthyridin-2(1H)-ones as selective inhibitors of pp60(c-src). J Med Chem 43: 3134-47 (2000)
- Tintori, C; Fallacara, AL; Radi, M; Zamperini, C; Dreassi, E; Crespan, E; Maga, G; Schenone, S; Musumeci, F; Brullo, C; Richters, A; Gasparrini, F; Angelucci, A; Festuccia, C; Delle Monache, S; Rauh, D; Botta, M Combining X-ray crystallography and molecular modeling toward the optimization of pyrazolo[3,4-d]pyrimidines as potent c-Src inhibitors active in vivo against neuroblastoma. J Med Chem 58: 347-61 (2015)
- Alfaro-Lopez, J; Yuan, W; Phan, BC; Kamath, J; Lou, Q; Lam, KS; Hruby, VJ Discovery of a novel series of potent and selective substrate-based inhibitors of p60c-src protein tyrosine kinase: conformational and topographical constraints in peptide design. J Med Chem 41: 2252-60 (1998)
- Fraser, C; Dawson, JC; Dowling, R; Houston, DR; Weiss, JT; Munro, AF; Muir, M; Harrington, L; Webster, SP; Frame, MC; Brunton, VG; Patton, EE; Carragher, NO; Unciti-Broceta, A Rapid Discovery and Structure-Activity Relationships of Pyrazolopyrimidines That Potently Suppress Breast Cancer Cell Growth via SRC Kinase Inhibition with Exceptional Selectivity over ABL Kinase. J Med Chem 59: 4697-710 (2016)
- Lesuisse, D; Lange, G; Deprez, P; Bénard, D; Schoot, B; Delettre, G; Marquette, JP; Broto, P; Jean-Baptiste, V; Bichet, P; Sarubbi, E; Mandine, E SAR and X-ray. A new approach combining fragment-based screening and rational drug design: application to the discovery of nanomolar inhibitors of Src SH2. J Med Chem 45: 2379-87 (2002)
- PubChem, PC Dose response biochemical High Throughput Screening assay for agonists of the steroid receptor coactivator 1 (SRC-1) recruitment by the peroxisome proliferator-activated receptor gamma (PPARgamma) PubChem Bioassay (2008)
- PubChem, PC Dose response biochemical High Throughput Screening assay for agonists of the steroid receptor coactivator 2 (SRC-2) recruitment by the peroxisome proliferator-activated receptor gamma (PPARgamma) PubChem Bioassay (2008)
- PubChem, PC Dose response biochemical High Throughput Screening assay for agonists of the steroid receptor coactivator 3 (SRC-3) recruitment by the peroxisome proliferator-activated receptor gamma (PPARgamma) PubChem Bioassay (2008)
- Lange, G; Lesuisse, D; Deprez, P; Schoot, B; Loenze, P; Benard, D; Marquette, JP; Broto, P; Sarubbi, E; Mandine, E Requirements for specific binding of low affinity inhibitor fragments to the SH2 domain of (pp60)Src are identical to those for high affinity binding of full length inhibitors. J Med Chem 46: 5184-95 (2003)
- Shakespeare, WC; Wang, Y; Bohacek, R; Keenan, T; Sundaramoorthi, R; Metcalf, C; Dilauro, A; Roeloffzen, S; Liu, S; Saltmarsh, J; Paramanathan, G; Dalgarno, D; Narula, S; Pradeepan, S; van Schravendijk, MR; Keats, J; Ram, M; Liou, S; Adams, S; Wardwell, S; Bogus, J; Iuliucci, J; Weigele, M; Xing, L; Boyce, B; Sawyer, TK SAR of carbon-linked, 2-substituted purines: synthesis and characterization of AP23451 as a novel bone-targeted inhibitor of Src tyrosine kinase with in vivo anti-resorptive activity. Chem Biol Drug Des 71: 97-105 (2008)
- Thompson, AM; Fry, DW; Kraker, AJ; Denny, WA Tyrosine kinase inhibitors. 2. Synthesis of 2,2'-dithiobis(1H-indole-3-alkanamides) and investigation of their inhibitory activity against epidermal growth factor receptor and pp60v-src protein tyrosine kinases. J Med Chem 37: 598-609 (1994)
- Kang, SU; Worthy, KM; Bindu, LK; Zhang, M; Yang, D; Fisher, RJ; Burke, TR Design and synthesis of 4-(alpha-hydroxymalonyl)phenylalanine as a new phosphotyrosyl mimetic and its use in growth factor receptor bound 2 src-homology 2 (Grb2 SH2) domain-binding peptides. J Med Chem 48: 5369-72 (2005)
- Chen, X; Shu, C; Li, W; Hou, Q; Luo, G; Yang, K; Wu, X Discovery of a Novel Src Homology-2 Domain Containing Protein Tyrosine Phosphatase-2 (SHP2) and Cyclin-Dependent Kinase 4 (CDK4) Dual Inhibitor for the Treatment of Triple-Negative Breast Cancer. J Med Chem 65: 6729-6747 (2022)
- Coleman, DR; Ren, Z; Mandal, PK; Cameron, AG; Dyer, GA; Muranjan, S; Campbell, M; Chen, X; McMurray, JS Investigation of the binding determinants of phosphopeptides targeted to the SRC homology 2 domain of the signal transducer and activator of transcription 3. Development of a high-affinity peptide inhibitor. J Med Chem 48: 6661-70 (2005)
- Mandal, PK; Morlacchi, P; Knight, JM; Link, TM; Lee, GR; Nurieva, R; Singh, D; Dhanik, A; Kavraki, L; Corry, DB; Ladbury, JE; McMurray, JS Targeting the Src Homology 2 (SH2) Domain of Signal Transducer and Activator of Transcription 6 (STAT6) with Cell-Permeable, Phosphatase-Stable Phosphopeptide Mimics Potently Inhibits Tyr641 Phosphorylation and Transcriptional Activity. J Med Chem 58: 8970-84 (2015)
- Noronha, G; Barrett, K; Boccia, A; Brodhag, T; Cao, J; Chow, CP; Dneprovskaia, E; Doukas, J; Fine, R; Gong, X; Gritzen, C; Gu, H; Hanna, E; Hood, JD; Hu, S; Kang, X; Key, J; Klebansky, B; Kousba, A; Li, G; Lohse, D; Mak, CC; McPherson, A; Palanki, MS; Pathak, VP; Renick, J; Shi, F; Soll, R; Splittgerber, U; Stoughton, S; Tang, S; Yee, S; Zeng, B; Zhao, N; Zhu, H Discovery of [7-(2,6-dichlorophenyl)-5-methylbenzo [1,2,4]triazin-3-yl]-[4-(2-pyrrolidin-1-ylethoxy)phenyl]amine--a potent, orally active Src kinase inhibitor with anti-tumor activity in preclinical assays. Bioorg Med Chem Lett 17: 602-8 (2007)
- Zhang, CH; Zheng, MW; Li, YP; Lin, XD; Huang, M; Zhong, L; Li, GB; Zhang, RJ; Lin, WT; Jiao, Y; Wu, XA; Yang, J; Xiang, R; Chen, LJ; Zhao, YL; Cheng, W; Wei, YQ; Yang, SY Design, Synthesis, and Structure-Activity Relationship Studies of 3-(Phenylethynyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine Derivatives as a New Class of Src Inhibitors with Potent Activities in Models of Triple Negative Breast Cancer. J Med Chem 58: 3957-74 (2015)
- Hennequin, LF; Allen, J; Breed, J; Curwen, J; Fennell, M; Green, TP; Lambert-van der Brempt, C; Morgentin, R; Norman, RA; Olivier, A; Otterbein, L; Ple, PA; Warin, N; Costello, G N-(5-chloro-1,3-benzodioxol-4-yl)-7-[2-(4-methylpiperazin-1-yl)ethoxy]-5-(tetrahydro-2H-pyran-4-yloxy)quinazolin-4-amine, a novel, highly selective, orally available, dual-specific c-Src/Abl kinase inhibitor. J Med Chem 49: 6465-88 (2006)
- Lombardo, LJ; Lee, FY; Chen, P; Norris, D; Barrish, JC; Behnia, K; Castaneda, S; Cornelius, LA; Das, J; Doweyko, AM; Fairchild, C; Hunt, JT; Inigo, I; Johnston, K; Kamath, A; Kan, D; Klei, H; Marathe, P; Pang, S; Peterson, R; Pitt, S; Schieven, GL; Schmidt, RJ; Tokarski, J; Wen, ML; Wityak, J; Borzilleri, RM Discovery of N-(2-chloro-6-methyl- phenyl)-2-(6-(4-(2-hydroxyethyl)- piperazin-1-yl)-2-methylpyrimidin-4- ylamino)thiazole-5-carboxamide (BMS-354825), a dual Src/Abl kinase inhibitor with potent antitumor activity in preclinical assays. J Med Chem 47: 6658-61 (2004)
- Liang, X; Liu, X; Wang, B; Zou, F; Wang, A; Qi, S; Chen, C; Zhao, Z; Wang, W; Qi, Z; Lv, F; Hu, Z; Wang, L; Zhang, S; Liu, Q; Liu, J Discovery of 2-((3-Amino-4-methylphenyl)amino)-N-(2-methyl-5-(3-(trifluoromethyl)benzamido)phenyl)-4-(methylamino)pyrimidine-5-carboxamide (CHMFL-ABL-053) as a Potent, Selective, and Orally Available BCR-ABL/SRC/p38 Kinase Inhibitor for Chronic Myeloid Leukemia. J Med Chem 59: 1984-2004 (2016)
- Dawson, MI; Xia, Z; Jiang, T; Ye, M; Fontana, JA; Farhana, L; Patel, B; Xue, LP; Bhuiyan, M; Pellicciari, R; Macchiarulo, A; Nuti, R; Zhang, XK; Han, YH; Tautz, L; Hobbs, PD; Jong, L; Waleh, N; Chao, WR; Feng, GS; Pang, Y; Su, Y Adamantyl-substituted retinoid-derived molecules that interact with the orphan nuclear receptor small heterodimer partner: effects of replacing the 1-adamantyl or hydroxyl group on inhibition of cancer cell growth, induction of cancer cell apoptosis, and inhibition of SRC homology 2 domain-containi J Med Chem 51: 5650-62 (2008)
- Das, J; Chen, P; Norris, D; Padmanabha, R; Lin, J; Moquin, RV; Shen, Z; Cook, LS; Doweyko, AM; Pitt, S; Pang, S; Shen, DR; Fang, Q; de Fex, HF; McIntyre, KW; Shuster, DJ; Gillooly, KM; Behnia, K; Schieven, GL; Wityak, J; Barrish, JC 2-aminothiazole as a novel kinase inhibitor template. Structure-activity relationship studies toward the discovery of N-(2-chloro-6-methylphenyl)-2-[[6-[4-(2-hydroxyethyl)-1- piperazinyl)]-2-methyl-4-pyrimidinyl]amino)]-1,3-thiazole-5-carboxamide (dasatinib, BMS-354825) as a potent pan-Src kinase i J Med Chem 49: 6819-32 (2006)
- Chen, P; Doweyko, AM; Norris, D; Gu, HH; Spergel, SH; Das, J; Moquin, RV; Lin, J; Wityak, J; Iwanowicz, EJ; McIntyre, KW; Shuster, DJ; Behnia, K; Chong, S; de Fex, H; Pang, S; Pitt, S; Shen, DR; Thrall, S; Stanley, P; Kocy, OR; Witmer, MR; Kanner, SB; Schieven, GL; Barrish, JC Imidazoquinoxaline Src-family kinase p56Lck inhibitors: SAR, QSAR, and the discovery of (S)-N-(2-chloro-6-methylphenyl)-2-(3-methyl-1-piperazinyl)imidazo- [1,5-a]pyrido[3,2-e]pyrazin-6-amine (BMS-279700) as a potent and orally active inhibitor with excellent in vivo antiinflammatory activity. J Med Chem 47: 4517-29 (2004)
- Menichincheri, M; Albanese, C; Alli, C; Ballinari, D; Bargiotti, A; Caldarelli, M; Ciavolella, A; Cirla, A; Colombo, M; Colotta, F; Croci, V; D'Alessio, R; D'Anello, M; Ermoli, A; Fiorentini, F; Forte, B; Galvani, A; Giordano, P; Isacchi, A; Martina, K; Molinari, A; Moll, JK; Montagnoli, A; Orsini, P; Orzi, F; Pesenti, E; Pillan, A; Roletto, F; Scolaro, A; Tatò, M; Tibolla, M; Valsasina, B; Varasi, M; Vianello, P; Volpi, D; Santocanale, C; Vanotti, E J Med Chem 53: 7296-315 (2010)
- Menichincheri, M; Bargiotti, A; Berthelsen, J; Bertrand, JA; Bossi, R; Ciavolella, A; Cirla, A; Cristiani, C; Croci, V; Damppound39Alessio, R; Fasolini, M; Fiorentini, F; Forte, B; Isacchi, A; Martina, K; Molinari, A; Montagnoli, A; Orsini, P; Orzi, F; Pesenti, E; Pezzetta, D; Pillan, A; Poggesi, I; Roletto, F; Scolaro, A; Tatò, M; Tibolla, M; Valsasina, B; Varasi, M; Volpi, D; Santocanale, C; Vanotti, E J Med Chem 52: 293-307 (2009)
- Aguirre, AL; Chheda, PR; Lentz, SRC; Held, HA; Groves, NP; Hiasa, H; Kerns, RJ Bioorg Med Chem 28: (2020)
- ChEBML_209908 Inhibition of HIV-1 nuclear regulatory protein Tat
- ChEMBL_434784 (CHEMBL917012) Inhibition of Tat-mediated transcription of viral promoter in 293 T cells transfected with HIV1 tat by luciferase reporter gene assay
- ChEMBL_209908 (CHEMBL811912) Inhibition of HIV-1 nuclear regulatory protein Tat
- ChEMBL_320712 (CHEMBL881698) In vitro binding affinity towards Tat/TAR to determine interaction between TAR RNA and Tat peptide at room temperature using fluorescence spectrophotometer
- ChEMBL_202596 (CHEMBL806420) Binding affinity against Src-homology 2 (SRC SH2).
- ChEBML_209906 Inhibition of Tat peptide binding to HIV-1 TAR RNA
- ChEMBL_874646 (CHEMBL2187094) Inhibition of biotinylated Tat-KAc50 peptide binding to PCAF
- ChEBML_210718 Inhibition of prednisilone-induced tyrosine aminotransferase (TAT) activity in rat hepatocytes
- ChEMBL_209906 (CHEMBL811910) Inhibition of Tat peptide binding to HIV-1 TAR RNA
- ChEBML_202599 Inhibition of Src kinase
- ChEBML_202602 Inhibition of Src kinase
- ChEBML_216846 Inhibition of c-SRC
- ChEMBL_2276621 Inhibition SRC (unknown origin)
- ChEMBL_2545610 Inhibition of human src
- ChEMBL_354923 (CHEMBL870114) Inhibition of Src
- ChEMBL_368585 (CHEMBL866830) Inhibition of Src
- ChEMBL_422671 (CHEMBL913339) Inhibition of SRC
- ChEMBL_429071 (CHEMBL919915) Inhibition of SRC
- ChEMBL_434555 (CHEMBL914202) Inhibition of Src
- ChEMBL_437736 (CHEMBL905921) Inhibition of Src
- ChEMBL_446047 (CHEMBL895117) Inhibition of Src
- ChEMBL_446779 (CHEMBL897079) Inhibition of Src
- ChEMBL_446810 (CHEMBL897109) Inhibition of Src
- ChEMBL_451332 (CHEMBL901543) Inhibition of Src
- ChEMBL_454144 (CHEMBL903333) Inhibition of SRC
- ChEMBL_454468 (CHEMBL902557) Inhibition of Src
- ChEMBL_456443 (CHEMBL907532) Inhibition of Src
- ChEMBL_457650 (CHEMBL923927) Inhibition of SRC
- ChEMBL_457659 (CHEMBL923937) Inhibition of Src
- ChEMBL_457888 (CHEMBL924160) Inhibition of Src
- ChEMBL_458496 (CHEMBL941812) Inhibition of SRC
- ChEMBL_470273 (CHEMBL951159) Inhibition of Src
- ChEMBL_471138 (CHEMBL921291) Inhibition of SRC
- ChEMBL_473234 (CHEMBL932925) Inhibition of Src
- ChEMBL_473604 (CHEMBL939372) Inhibition of Src
- ChEMBL_489687 (CHEMBL982992) Inhibition of SRC
- ChEMBL_491689 (CHEMBL949544) Inhibition of Src
- ChEMBL_492924 (CHEMBL945312) Inhibition of SRC
- ChEMBL_499164 (CHEMBL1011438) Inhibition of SRC
- ChEMBL_500034 (CHEMBL1025482) Inhibition of SRC
- ChEMBL_501674 (CHEMBL981422) Inhibition of Src
- ChEMBL_515231 (CHEMBL991254) Inhibition of Src
- ChEMBL_519332 (CHEMBL947784) Inhibition of Src
- ChEMBL_520717 (CHEMBL949885) Inhibition of SRC
- ChEMBL_531112 (CHEMBL973087) Inhibition of Src
- ChEMBL_535208 (CHEMBL990804) Inhibition of Src
- ChEMBL_543838 (CHEMBL1016028) Inhibition of Src
- ChEMBL_563036 (CHEMBL1011866) Inhibition of Src
- ChEMBL_571604 (CHEMBL1029458) Inhibition of Src
- ChEMBL_571642 (CHEMBL1031297) Inhibition of Src
- ChEMBL_575545 (CHEMBL1035542) Inhibition of SRC
- ChEMBL_586035 (CHEMBL1063592) Inhibition of Src
- ChEMBL_593162 (CHEMBL1044076) Inhibition of Src
- ChEMBL_598136 (CHEMBL1039166) Inhibition of Src
- ChEMBL_603254 (CHEMBL1049478) Inhibition of SRC
- ChEMBL_603267 (CHEMBL1049491) Inhibition of Src
- ChEMBL_606956 (CHEMBL1073283) Inhibition of SRC
- ChEMBL_610617 (CHEMBL1069631) Inhibition of SRC
- ChEMBL_612342 (CHEMBL1065594) Inhibition of Src
- ChEMBL_614211 (CHEMBL1105161) Inhibition of Src
- ChEMBL_614491 (CHEMBL1110559) Inhibition of Src
- ChEMBL_616311 (CHEMBL1102114) Inhibition of SRC
- ChEMBL_619935 (CHEMBL1113977) Inhibition of SRC
- ChEMBL_619955 (CHEMBL1113997) Inhibition of SRC
- ChEMBL_620231 (CHEMBL1115866) Inhibition of SRC
- ChEMBL_620621 (CHEMBL1114829) Inhibition of SRC
- ChEMBL_623811 (CHEMBL1117094) Inhibition of SRC
- ChEMBL_624537 (CHEMBL1110586) Inhibition of SRC
- ChEMBL_624656 (CHEMBL1111616) Inhibition of SRC
- ChEMBL_625001 (CHEMBL1109669) Inhibition of Src
- ChEMBL_627132 (CHEMBL1110869) Inhibition of Src
- ChEMBL_627199 (CHEMBL1114553) Inhibition of SRC
- ChEMBL_628530 (CHEMBL1104652) Inhibition of SRC
- ChEMBL_633630 (CHEMBL1117888) Inhibition of SRC
- ChEMBL_634494 (CHEMBL1120009) Inhibition of SRC
- ChEMBL_635428 (CHEMBL1120228) Inhibition of SRC
- ChEMBL_655281 (CHEMBL1244325) Inhibition of SRC
- ChEMBL_663754 (CHEMBL1250654) Inhibition of SRC
- ChEMBL_665426 (CHEMBL1261155) Inhibition of Src
- ChEMBL_686625 (CHEMBL1292420) Inhibition of SRC
- ChEMBL_696615 (CHEMBL1641166) Inhibition of Src
- ChEMBL_739841 (CHEMBL1762901) Inhibition of Src
- ChEMBL_742159 (CHEMBL1769219) Inhibition of SRC
- ChEMBL_795652 (CHEMBL1936082) Inhibition of Src
- ChEMBL_803527 (CHEMBL1953275) Inhibition of Src
- ChEMBL_806861 (CHEMBL1958989) Inhibition of Src
- ChEMBL_813579 (CHEMBL2019688) Inhibition of SRC
- ChEMBL_819193 (CHEMBL2032462) Inhibition of Src
- ChEMBL_821891 (CHEMBL2039537) Inhibition of SRC
- ChEMBL_831928 (CHEMBL2066002) Inhibition of SRC
- ChEMBL_841526 (CHEMBL2091832) Inhibition of SRC
- ChEMBL_850926 (CHEMBL2156909) Inhibition of SRC
- ChEMBL_881461 (CHEMBL2214448) Inhibition of SRC
- ChEMBL_883074 (CHEMBL2210718) Inhibition of Src
- ChEMBL_306410 (CHEMBL828751) Inhibition v-src sarcoma viral oncogene homolog (Src) at 100 uM ATP
- ChEMBL_1869998 (CHEMBL4371165) Inhibition of full length human recombinant pp60c-src using RR-SRC as substrate
- ChEBML_195915 Inhibition of human c-Src
- ChEBML_200375 Inhibition of Src tyrosine kinase
- ChEBML_217012 Inhibition of c-src kinase
- ChEMBL_1337691 (CHEMBL3242879) Inhibition of human Src
- ChEMBL_1476339 (CHEMBL3429862) Inhibition of human Src
- ChEMBL_1970092 (CHEMBL4602910) Inhibition of human SRC
- ChEMBL_202604 (CHEMBL806428) Inhibition of Src kinase
- ChEMBL_202767 (CHEMBL808763) Inhibition of src kinase
- ChEMBL_202768 (CHEMBL808764) Inhibition of src kinase
- ChEMBL_2061795 (CHEMBL4717048) Inhibition of human SRC
- ChEMBL_2113641 (CHEMBL4822491) Inhibition of human SRC
- ChEMBL_2268541 Inhibition of src (unknown origin)
- ChEMBL_2270566 Inhibition of Src (unknown origin)
- ChEMBL_2280916 Inhibition of Src (unknown origin)
- ChEMBL_2284062 Inhibition of SRC (unknown origin)
- ChEMBL_2284841 Inhibition of SRC (unknown origin)
- ChEMBL_2285696 Inhibition of Src (unknown origin)
- ChEMBL_2345992 Inhibition of SRC (unknown origin)
- ChEMBL_2455939 Inhibition of SRC (unknown origin)
- ChEMBL_2467205 Inhibition of Src (unknown origin)
- ChEMBL_2513781 Inhibition of Src (unknown origin)
- ChEMBL_2516380 Inhibition of SRC (unknown origin)
- ChEMBL_2525804 Inhibition of Src (unknown origin)
- ChEMBL_2544112 Inhibition of SRC (unknown origin)
- ChEMBL_2568980 Inhibition of SRC (unknown origin)
- ChEMBL_305893 (CHEMBL832908) Inhibition of Src kinase
- ChEMBL_326810 (CHEMBL860331) Inhibitory activity against Src
- ChEMBL_328631 (CHEMBL863882) Inhibitory activity against src
- ChEMBL_330902 (CHEMBL862117) Inhibitory activity against SRC
- ChEMBL_331454 (CHEMBL865228) Inhibitory activity against Src
- ChEMBL_379937 (CHEMBL864857) Inhibition of c-Src
- ChEMBL_420180 (CHEMBL912723) Inhibition of human SRC
- ChEMBL_430256 (CHEMBL914495) Inhibition of src kinase
- ChEMBL_448884 (CHEMBL898030) Inhibition of Src kinase
- ChEMBL_453857 (CHEMBL885859) Inhibition of Src activity
- ChEMBL_462950 (CHEMBL929884) Inhibition of c-src
- ChEMBL_473627 (CHEMBL937643) Inhibition of c-Src
- ChEMBL_501027 (CHEMBL978937) Inhibition of c-Src
- ChEMBL_506526 (CHEMBL945560) Inhibition of p60 src
- ChEMBL_508801 (CHEMBL997069) Inhibition of Src kinase
- ChEMBL_511308 (CHEMBL996963) Inhibition of c-Src
- ChEMBL_526698 (CHEMBL970972) Inhibition of c-Src
- ChEMBL_531323 (CHEMBL989735) Inhibition of c-Src
- ChEMBL_545105 (CHEMBL1018047) Inhibition of human Src
- ChEMBL_552455 (CHEMBL1002715) Inhibition of c-Src
- ChEMBL_553938 (CHEMBL962871) Inhibition of recombinant SRC
- ChEMBL_557463 (CHEMBL962241) Inhibition of human SRC
- ChEMBL_560793 (CHEMBL1011760) Binding affinity to SRC
- ChEMBL_563100 (CHEMBL1022370) Inhibition of Src kinase
- ChEMBL_574951 (CHEMBL1026231) Inhibition of recombinant SRC
- ChEMBL_597770 (CHEMBL1046248) Inhibition of src kinase
- ChEMBL_655054 (CHEMBL1244098) Inhibition of human Src
- ChEMBL_655938 (CHEMBL1244982) Binding affinity to SRC
- ChEMBL_727263 (CHEMBL1687357) Inhibition of c-Src
- ChEMBL_729672 (CHEMBL1696960) Inhibition of Src kinase
- ChEMBL_742989 (CHEMBL1768404) Inhibition of c-SRC
- ChEMBL_743118 (CHEMBL1768694) Inhibition of c-Src
- ChEMBL_748306 (CHEMBL1781316) Inhibition of c-SRC
- ChEMBL_762210 (CHEMBL1816281) Inhibition of c-SRC
- ChEMBL_773559 (CHEMBL1839925) Inhibition of recombinant SRC
- ChEMBL_793864 (CHEMBL1932837) Inhibition of c-SRC
- ChEMBL_830077 (CHEMBL2061830) Inhibition of human SRC
- ChEMBL_834781 (CHEMBL2073049) Inhibition of c-Src
- ChEBML_202609 Inhibition of Src protein tyrosine kinase
- ChEBML_202612 Inhibition of Src protein tyrosine kinase
- ChEBML_202618 Affinity for Src protein tyrosine kinase
- ChEBML_202620 Inhibition of Src protein tyrosine kinase
- ChEBML_202623 Inhibition of Src protein tyrosine kinase
- ChEBML_202625 Inhibition of Src protein tyrosine kinase
- ChEBML_202631 Inhibition of Src protein tyrosine kinase
- ChEBML_202766 Inhibition of Src protein tyrosine kinase
- ChEBML_216849 Inhibition of tyrosine kinase(c-Src)
- ChEBML_216856 Inhibition of c-Src tyrosine kinase
- ChEBML_216987 Inhibition of c-Src-tyrosine kinase.
- ChEMBL_1352445 (CHEMBL3270966) Inhibition of SRC (unknown origin)
- ChEMBL_1465694 (CHEMBL3405455) Inhibition of SRC (unknown origin)
- ChEMBL_1501946 (CHEMBL3588353) Inhibition of human recombinant Src
- ChEMBL_1526222 (CHEMBL3636907) Inhibition of SRC (unknown origin)
- ChEMBL_1543011 (CHEMBL3743751) Inhibition of SRC (unknown origin)
- ChEMBL_1544632 (CHEMBL3750476) Inhibition of Src (unknown origin)
- ChEMBL_1613128 (CHEMBL3854928) Inhibition of Src (unknown origin)
- ChEMBL_1616896 (CHEMBL3858965) Inhibition of SRC (unknown origin)
- ChEMBL_1706737 (CHEMBL4057970) Inhibition of SRC (unknown origin)
- ChEMBL_1776420 (CHEMBL4233412) Inhibition of SRC (unknown origin)
- ChEMBL_1778447 (CHEMBL4235439) Inhibition of SRC (unknown origin)
- ChEMBL_1806461 (CHEMBL4305820) Inhibition of SRC (unknown origin)
- ChEMBL_1842462 (CHEMBL4342889) Inhibition of SRC (unknown origin)
- ChEMBL_1870044 (CHEMBL4371211) Inhibition of Src (unknown origin)
- ChEMBL_1870310 (CHEMBL4371477) Inhibition of SRC (unknown origin)
- ChEMBL_1876859 (CHEMBL4378253) Inhibition of SRC (unknown origin)
- ChEMBL_1933802 (CHEMBL4479454) Inhibition of human c- SRC
- ChEMBL_1983553 (CHEMBL4616959) Inhibition of SRC (unknown origin)
- ChEMBL_200373 (CHEMBL806344) Inhibition of Src tyrosine kinase
- ChEMBL_200374 (CHEMBL806345) Inhibition of Src tyrosine kinase
- ChEMBL_2021704 (CHEMBL4675517) Inhibition of SRC (unknown origin)
- ChEMBL_2025906 (CHEMBL4679719) Inhibition of SRC (unknown origin)
- ChEMBL_2060309 (CHEMBL4715310) Inhibition of SRC (unknown origin)
- ChEMBL_2069115 (CHEMBL4724368) Inhibition of SRC (unknown origin)
- ChEMBL_2071894 (CHEMBL4727428) Inhibition of SRC (unknown origin)
- ChEMBL_2074186 (CHEMBL4729720) Inhibition of Src (unknown origin)
- ChEMBL_2112723 (CHEMBL4821573) Inhibition of SRC (unknown origin)
- ChEMBL_2129604 (CHEMBL4839033) Inhibition of Src (unknown origin)
- ChEMBL_2131763 (CHEMBL4841278) Inhibition of SRC (unknown origin)
- ChEMBL_2147383 (CHEMBL5031729) Inhibition of Src (unknown origin)
- ChEMBL_2187360 (CHEMBL5099442) Inhibition of SRC (unknown origin)
- ChEMBL_2192343 (CHEMBL5104703) Inhibition of SRC (unknown origin)
- ChEMBL_2196448 (CHEMBL5108964) Inhibition of SRC (unknown origin)
- ChEMBL_2198801 (CHEMBL5111317) Inhibition of SRC (unknown origin)
- ChEMBL_2206798 (CHEMBL5119506) Inhibition of Src (unknown origin)
- ChEMBL_2208418 (CHEMBL5121367) Inhibition of Src (unknown origin)
- ChEMBL_2218428 (CHEMBL5131762) Inhibition of SRC (unknown origin)
- ChEMBL_2218644 (CHEMBL5131978) Inhibition of SRC (unknown origin)
- ChEMBL_2224511 (CHEMBL5138024) Inhibition of src (unknown origin)
- ChEMBL_2246849 (CHEMBL5161059) Inhibition of SRC (unknown origin)
- ChEMBL_2251068 (CHEMBL5165278) Inhibition of SRC (unknown origin)
- ChEMBL_2252050 (CHEMBL5166260) Inhibition of Src (unknown origin)
- ChEMBL_2267569 Inhibition of c-Src (unknown origin)
- ChEMBL_2270713 Inhibition of c-Src (unknown origin)
- ChEMBL_2284542 Inhibition of c-Src (unknown origin)
- ChEMBL_2525080 Inhibition of recombinant SRC (unknown origin)
- ChEMBL_2525648 Inhibition of c-src (unknown origin)
- ChEMBL_2526116 Inhibition of recombinant Src (unknown origin)
- ChEMBL_321139 (CHEMBL872195) Inhibitory concentration against Src kinase
- ChEMBL_325231 (CHEMBL861592) Inhibitory activity against c-SRC
- ChEMBL_384714 (CHEMBL869797) Inhibition of human recombinant Src
- ChEMBL_384715 (CHEMBL869798) Inhibition of Src dependent proliferation
- ChEMBL_450769 (CHEMBL899855) Inhibition of human recombinant Src
- ChEMBL_510661 (CHEMBL1003141) Inhibition of p60 c-Src
- ChEMBL_555001 (CHEMBL957976) Inhibition of human recombinant SRC
- ChEMBL_583405 (CHEMBL1056606) Inhibition of human recombinant Src
- ChEMBL_595125 (CHEMBL1050612) Inhibition of human recombinant Src
- ChEMBL_887649 (CHEMBL2217258) Inhibition of chicken c-Src
- ChEMBL_930887 (CHEMBL3075220) Inhibition of SRC (unknown origin)
- ChEMBL_937901 (CHEMBL2317041) Inhibition of SRC (unknown origin)
- ChEMBL_943785 (CHEMBL2345798) Inhibition of Src (unknown origin)
- ChEMBL_944304 (CHEMBL2343954) Inhibition of SRC (unknown origin)
- ChEMBL_947479 (CHEMBL2345555) Inhibition of SRC (unknown origin)
- ChEMBL_221790 (CHEMBL843184) Inhibitory concentration of the against pp60v-src tyrosine kinase obtained from v-src baculovirus-infected insect cells
- ChEMBL_1537770 (CHEMBL3737649) Antagonist activity at glucocorticoid receptor in rat H4IIEC3 cells assessed as glucocorticoid-induced TAT activity
- ChEBML_202595 Inhibition of binding to Src SH2 domain
- ChEBML_216848 Inhibition of protein tyrosine kinase c-Src
- ChEBML_216991 Inhibitory activity against c-src tyrosine kinase
- ChEBML_221673 Inhibition of cellular oncogene pp60 c-src
- ChEBML_225039 Inhibition of src at 5 mM ATP
- ChEMBL_1446503 (CHEMBL3376777) Inhibition of c-Src (unknown origin)
- ChEMBL_1455379 (CHEMBL3363275) Inhibition of Src kinase (unknown origin)
- ChEMBL_1476345 (CHEMBL3429868) Inhibition of human Src T341M mutant
- ChEMBL_1517133 (CHEMBL3619916) Inhibition of c-Src (unknown origin)
- ChEMBL_1544387 (CHEMBL3748463) Inhibition of c-Src (unknown origin)
- ChEMBL_1563358 (CHEMBL3784716) Binding affinity to SRC (unknown origin)
- ChEMBL_1723837 (CHEMBL4139115) Inhibition of Src kinase (unknown origin)
- ChEMBL_1730366 (CHEMBL4145902) Inhibition of c-SRC (unknown origin)
- ChEMBL_1869616 (CHEMBL4370682) Inhibition of pp60 src (unknown origin)
- ChEMBL_1876862 (CHEMBL4378256) Inhibition of SRC phosphorylation (unknown origin)
- ChEMBL_202593 (CHEMBL806417) Binding affinity for Src SH2 domain
- ChEMBL_202603 (CHEMBL806427) Inhibition of recombinant human Src kinase
- ChEMBL_202605 (CHEMBL806429) Inhibition of Src protein tyrosine kinase
- ChEMBL_202618 (CHEMBL805363) Affinity for Src protein tyrosine kinase
- ChEMBL_202619 (CHEMBL805364) Inhibition of Src protein tyrosine kinase
- ChEMBL_202620 (CHEMBL805365) Inhibition of Src protein tyrosine kinase
- ChEMBL_202621 (CHEMBL805366) Inhibition of Src protein tyrosine kinase
- ChEMBL_202622 (CHEMBL805367) Inhibition of Src protein tyrosine kinase
- ChEMBL_202631 (CHEMBL805895) Inhibition of Src protein tyrosine kinase
- ChEMBL_202770 (CHEMBL808766) Inhibition of Src protein tyrosine kinase
- ChEMBL_202771 (CHEMBL808767) Inhibition of Src protein tyrosine kinase
- ChEMBL_202772 (CHEMBL873261) Inhibition of Src protein tyrosine kinase
- ChEMBL_2093877 (CHEMBL4775140) Inhibition of c-SRC (unknown origin)
- ChEMBL_216864 (CHEMBL816863) Inhibition of c-Src tyrosine kinase.
- ChEMBL_216986 (CHEMBL822802) Inhibition of C-src tyrosine kinase
- ChEMBL_216989 (CHEMBL822805) Inhibition of tyrosine kinase c-Src
- ChEMBL_216992 (CHEMBL822807) Inhibition of c-Src tyrosine kinase
- ChEMBL_216993 (CHEMBL822808) Inhibition of tyrosine kinase c-Src
- ChEMBL_2185237 (CHEMBL5097319) Inhibition of c-Src (unknown origin)
- ChEMBL_304754 (CHEMBL829352) Inhibitory activity against Src tyrosine kinase
- ChEMBL_304908 (CHEMBL827802) Inhibition of c-SRC tyrosine kinase
- ChEMBL_326930 (CHEMBL863345) Inhibitory activity against c-Src kinase
- ChEMBL_360487 (CHEMBL859156) Binding affinity to human recombinant Src
- ChEMBL_424208 (CHEMBL908982) Inhibition of human recombinant Src kinase
- ChEMBL_442112 (CHEMBL891250) Inhibition of SRC by radiometric assay
- ChEMBL_453858 (CHEMBL885860) Inhibition of Src in rat fibroblasts
- ChEMBL_455238 (CHEMBL906399) Inhibition of Src by HTRF assay
- ChEMBL_464764 (CHEMBL930130) Inhibition of SRC by HTRF assay
- ChEMBL_469609 (CHEMBL934188) Inhibition of Src by HTRF assay
- ChEMBL_489724 (CHEMBL986499) Inhibition of c-Src by ELISA
- ChEMBL_529512 (CHEMBL966656) Inhibition of human Src by ELISA
- ChEMBL_531124 (CHEMBL974010) Inhibition of Src by cellular assay
- ChEMBL_571269 (CHEMBL1024395) Inhibition of c-SRC SH2 domain
- ChEMBL_586361 (CHEMBL1061927) Binding constant for SRC kinase domain
- ChEMBL_621347 (CHEMBL1109440) Inhibition of Src after 1 hr
- ChEMBL_659335 (CHEMBL1247962) Inhibition of Src by HTRF assay
- ChEMBL_774496 (CHEMBL1908713) Binding constant for SRC kinase domain
- ChEMBL_811394 (CHEMBL2013606) Inhibition of SRC by DEL method
- ChEMBL_831800 (CHEMBL2065163) Inhibition of SRC by FRET assay
- ChEMBL_847981 (CHEMBL2150417) Inhibition of Src after 5 mins
- ChEBML_210862 Binding affinity for Human pp60c-src SH2 domain
- ChEBML_70387 Affinity for GST- Src-SH2 domain in ELISA
- ChEMBL_1461213 (CHEMBL3395776) Inhibition of c-src kinase (unknown origin)
- ChEMBL_202589 (CHEMBL806413) Inhibition of binding to Src SH2 domain
- ChEMBL_202591 (CHEMBL806415) Inhibition of binding to Src SH2 domain
- ChEMBL_202626 (CHEMBL805371) Inhibitory activity against Src protein tyrosine kinase
- ChEMBL_202791 (CHEMBL809571) Inhibition of binding to Src SH2 domain
- ChEMBL_2069117 (CHEMBL4724370) Inhibition of SRC S345C mutant (unknown origin)
- ChEMBL_2128774 (CHEMBL4838203) Inhibition of SRC (unknown origin) by ELISA
- ChEMBL_216860 (CHEMBL816697) Inhibition of chicken c-Src tyrosine kinase
- ChEMBL_216999 (CHEMBL821534) Inhibitory activity against c-src tyrosine kinase
- ChEMBL_221784 (CHEMBL843059) Inhibition of p60 c-Src tyrosine kinase
- ChEMBL_2224510 (CHEMBL5138023) Inhibition of p60 c-src (unknown origin)
- ChEMBL_223446 (CHEMBL844770) Binding affinity to p60 src SH2 domain.
- ChEMBL_2237738 (CHEMBL5151634) Inhibition of recombinant c-Src (unknown origin)
- ChEMBL_2267360 Inhibition of human SRC by microplate reader analysis
- ChEMBL_2267361 Inhibition of human SRC by western blot assay
- ChEMBL_2297698 Inhibition of SRC (unknown origin) by Z'LYTE assay
- ChEMBL_2543605 Inhibition of human SRC in presence of ATP
- ChEMBL_326932 (CHEMBL854323) Inhibition of Src-transfected 3T3 cell proliferation
- ChEMBL_361955 (CHEMBL859180) Inhibition of SRC using polyE4Y as substrate
- ChEMBL_361956 (CHEMBL859179) Inhibition of SRC in presence of ATP
- ChEMBL_396643 (CHEMBL871537) Inhibition of Src by HTRF kinase assay
- ChEMBL_445013 (CHEMBL894114) Inhibition of recombinant SRC by radiometric assay
- ChEMBL_455057 (CHEMBL887086) Inhibition of Src by radioactive filtration assay
- ChEMBL_555657 (CHEMBL955811) Inhibition of Src by TR-FRET assay
- ChEMBL_566614 (CHEMBL960140) Inhibition of Src by virtual HTS assay
- ChEMBL_698986 (CHEMBL1646090) Inhibition of c-Src after 60 mins
- ChEMBL_70342 (CHEMBL677167) Inhibition of Src-transformed fibroblast cell proliferation
- ChEMBL_814874 (CHEMBL2026616) Inhibition of SRC by filter binding assay
- ChEMBL_818068 (CHEMBL2033710) Inhibition of human SRC by radiometric assay
- ChEMBL_931300 (CHEMBL3069803) Inhibition of c-Src kinase (unknown origin)
- ChEMBL_1540296 (CHEMBL3736642) Antagonist activity at glucocorticoid receptor in human primary hepatocytes assessed as inhibition of glucocorticoid-induced TAT activity
- ChEMBL_1540297 (CHEMBL3736643) Antagonist activity at glucocorticoid receptor in rat primary hepatocytes assessed as inhibition of glucocorticoid-induced TAT activity
- ChEMBL_1540299 (CHEMBL3736645) Agonist activity at glucocorticoid receptor in rat primary hepatocytes assessed as inhibition of glucocorticoid-induced TAT activity
- ChEMBL_199318 (CHEMBL805260) The compound was tested for inhibition of HIV-1 replication in SW480 cells using HIV tat assay
- ChEMBL_1802630 (CHEMBL4274922) Inhibition of Src (unknown origin) using Src-family kinase bisamide rhodamine 110 peptide substrate after 1 hr by fluorescence assay
- ChEBML_154714 Inhibition of src SH2 domain binding to PDGF receptor
- ChEBML_202785 Binding affinity for Src protein tyrosine kinase SH2 domain
- ChEBML_221661 Inhibition of human purified recombinant pp60c-src tyrosine kinase
- ChEBML_221664 Inhibition of human recombinant p60 c-Src tyrosine kinase
- ChEMBL_1517141 (CHEMBL3619924) Inhibition of c-Src E280G mutant (unknown origin)
- ChEMBL_1523704 (CHEMBL3631843) Inhibition of Src (unknown origin) by FRET method
- ChEMBL_1870043 (CHEMBL4371210) Inhibition of Src autophosphorylation in mouse GL261 cells
- ChEMBL_2045488 (CHEMBL4700187) Inhibition of human SRC by kinase-profiling analysis
- ChEMBL_216847 (CHEMBL818270) Inhibition of c-SRC with 1 uM ATP
- ChEMBL_221657 (CHEMBL823234) Inhibition of p60 c-Src tyrosine kinase activity
- ChEMBL_221658 (CHEMBL823235) Inhibition of p60 c-Src tyrosine kinase enzyme
- ChEMBL_221785 (CHEMBL843060) Inhibitory activity against p60 c-Src tyrosine kinase
- ChEMBL_2223274 (CHEMBL5136608) Inhibition of human c-SRC by kinase assay
- ChEMBL_2427411 Inhibition of SRC (unknown origin) by ADP-Glo assay
- ChEMBL_2502715 Inhibition of SRC (unknown origin) assessed as inhibition constant
- ChEMBL_2512805 Binding affinity to SRC in human Hs-578T cells
- ChEMBL_2525416 Inhibition of Src (unknown origin) in presence of ATP
- ChEMBL_2538210 Inhibition of human SRC by discoverX kinome scan assay
- ChEMBL_2574520 Inhibition of Src (unknown origin) by TR-FRET assay
- ChEMBL_336777 (CHEMBL864338) Inhibitory activity against Src in cell free assay
- ChEMBL_424917 (CHEMBL908549) Inhibition of human recombinant Src by ProFlour assay
- ChEMBL_478596 (CHEMBL934543) Inhibition of Src by luminescence based kinase assay
- ChEMBL_611551 (CHEMBL1066395) Inhibition of recombinant Src by TR-FRET assay
- ChEMBL_748775 (CHEMBL1780628) Inhibition of SRC-related membrane-associated tyrosine kinase
- ChEMBL_760765 (CHEMBL1815750) Inhibition of SRC by microfluidic mobility shift assay
- ChEMBL_766966 (CHEMBL1828293) Inhibition of SRC activity by TR-FRET assay
- ChEMBL_535874 (CHEMBL994994) Inhibition of TEL fused Src-mediated proliferation of TEL-Src transformed mouse BA/F3 cells after 48 hrs by bright-glo luciferase assay
- ChEBML_1448593 Inhibition of human recombinant SRC using poly(Glu,Tyr) substrate
- ChEBML_202616 Inhibition of Src-mediated dentine resorption in rabbit-osteoclast assay
- ChEMBL_1524003 (CHEMBL3630475) Inhibition of human Src kinase by kinase inhibition assay
- ChEMBL_154714 (CHEMBL764642) Inhibition of src SH2 domain binding to PDGF receptor
- ChEMBL_1784618 (CHEMBL4256135) Inhibition of SRC (unknown origin) by mobility shift assay
- ChEMBL_1847478 (CHEMBL4348019) Inhibition of SRC (unknown origin) by Z'-LYTE assay
- ChEMBL_202592 (CHEMBL806416) Inhibition of [125I]phosphopeptide binding to Src SH2 domain.
- ChEMBL_202630 (CHEMBL808216) Inhibition of Src protein tyrosine kinase dependent cellular proliferation
- ChEMBL_202785 (CHEMBL808039) Binding affinity for Src protein tyrosine kinase SH2 domain
- ChEMBL_202790 (CHEMBL808044) Inhibitory activity against Src protein tyrosine kinase SH2 domain
- ChEMBL_2087525 (CHEMBL4768788) Inhibition of human c-SRC in presence of ATP
- ChEMBL_2088708 (CHEMBL4769971) Inhibition of SRC (unknown origin) by ADP-Glo assay
- ChEMBL_2238056 (CHEMBL5151952) Inhibition of SRC (unknown origin) by kinase hotspot assay
- ChEMBL_2364273 Inhibition of human wild type c-Src by radiometric assay
- ChEMBL_2488347 Binding affinity to SRC (unknown origin) assessed as inhibition constant
- ChEMBL_2512335 Inhibition of c-SRC (unknown origin) in presence of ATP
- ChEMBL_2525137 Inhibition of recombinant Src (unknown origin) using peptide as substrate
- ChEMBL_320709 (CHEMBL881695) Dissociation constant against Src protein tyrosine kinase SH2 domain
- ChEMBL_321377 (CHEMBL881755) Inhibitory concentration against Src protein tyrosine kinase SH2 domain
- ChEMBL_506212 (CHEMBL942401) Inhibition of p60c-src expressed in chick embryo fibroblast
- ChEMBL_511627 (CHEMBL976274) Inhibition of human Src kinase by TR-FRET assay
- ChEMBL_536845 (CHEMBL991655) Inhibition of Src in presence of 100 uM ATP
- ChEMBL_572800 (CHEMBL1031881) Inhibition of human Src kinase by TR-FRET assay
- ChEMBL_586868 (CHEMBL1051363) Inhibition of Src in the presence of 50uM ATP
- ChEMBL_652997 (CHEMBL1226200) Inhibition of c-src in by radioactive phosphotransfer assay
- ChEMBL_728800 (CHEMBL1686335) Inhibition of GST-fussed c-SRC after 30 mins
- ChEMBL_807029 (CHEMBL1959421) Inhibition of Src using fluorescent substrate by IMAP assay
- ChEMBL_831581 (CHEMBL2064944) Inhibition of Src in presence of 10 uM ATP
- ChEMBL_876576 (CHEMBL2188533) Inhibition of human recombinant SRC by radiometric kinase assay
- ChEMBL_972667 (CHEMBL2410770) Inhibition of c-Src (unknown origin) by fluorescence assay
- ChEMBL_2084965 (CHEMBL4766228) Inhibition of Src in human MDA-MB-231 cells assessed as reduction in phosphorylation of Src incubated for 20 hrs by Western blot analysis
- ChEMBL_1540294 (CHEMBL3736640) Antagonist activity at glucocorticoid receptor in human HepG2 cells assessed as inhibition of glucocorticoid-induced TAT activity after 24 hrs
- ChEMBL_857678 (CHEMBL2168514) Antagonist activity at CCR5 receptor expressed in P4R5 cells co-expressing CD4, and LTR-beta-gal construct assessed as inhibition of infusion to HIV gp120 expressed in CHO-tat cells expressing HIV-1 JRFLenv and HIV-1 Tat by beta-galactosidase activity based cell-cell fusion assay
- ChEMBL_776316 (CHEMBL1914167) Transactivation activity at glucocorticoid receptor alpha human 13D3/Huh7 cells assessed as induction of TAT activity after 4 hrs by spectrophotometry
- ChEBML_221655 Binding affinity towards p60 Src tyrosine kinase using scintillation proximity assay
- ChEBML_221656 Inhibition of p60 c-Src tyrosine kinase at 830 ng/mL
- ChEMBL_1517134 (CHEMBL3619917) Inhibition of c-Src C277S, C483S, S496S mutant (unknown origin)
- ChEMBL_1524118 (CHEMBL3631059) Inhibition of Src (unknown origin) by radiometric protein kinase assay
- ChEMBL_1565919 (CHEMBL3790308) Inhibition of SRC (unknown origin) in presence of [gamma33P]ATP
- ChEMBL_1575402 (CHEMBL3802299) Inhibition of c-Src (unknown origin) by Z-LYTE assay
- ChEMBL_158515 (CHEMBL768942) Affinity for SH2 domain of src in Sf9 insect cells
- ChEMBL_1926317 (CHEMBL4429389) Inhibition of partial length human SRC expressed in bacterial system
- ChEMBL_2093687 (CHEMBL4774950) Inhibition of c-Src (unknown origin) in presence of ATP
- ChEMBL_2153005 (CHEMBL5037552) Inhibition of SRC N1 (unknown origin) by Z-lyte assay
- ChEMBL_216845 (CHEMBL818268) In vitro inhibition of c-SRC kinase expressed in baculovirus
- ChEMBL_216859 (CHEMBL816696) Tested for inhibition of protein tyrosine kinase c-Src phosphorylation
- ChEMBL_2236196 (CHEMBL5150092) Binding affinity to Src (unknown origin) assessed as inhibition constant
- ChEMBL_2543625 Inhibition of human SRC in presence of ATP by cellular assay
- ChEMBL_518627 (CHEMBL962772) Inhibition of human recombinant c-Src by filter-binding assay
- ChEMBL_591803 (CHEMBL1041543) Inhibition of Src by [gamma-33-P]ATP based assay
- ChEMBL_619938 (CHEMBL1113980) Inhibition of Tel-fused SRC expressed in mouse BAF3 cells
- ChEMBL_675745 (CHEMBL1272379) Inhibition of c-SRC by Hot Spot filtration binding assay
- ChEMBL_745919 (CHEMBL1776289) Inhibition of human recombinant c-Src by filter-binding assay
- ChEMBL_751377 (CHEMBL1785338) Inhibition of human Src using poly[Glu:Tyr] by Hotspot assay
- ChEMBL_821005 (CHEMBL2039192) Inhibition of Tel-fused SRC in mouse BA/F3 cells
- ChEMBL_797958 (CHEMBL1942835) Transactivation of glucocorticoid receptor in rat H42E cells assessed as induction of TAT measuring degradation of tyrosine to p-hydroxy phenyl pyruvate
- ChEMBL_797960 (CHEMBL1942837) Transactivation of glucocorticoid receptor in human HepG2 cells assessed as induction of TAT measuring degradation of tyrosine to p-hydroxy phenyl pyruvate
- ChEBML_1586056 Inhibition of SRC (unknown origin) incubated for 1 hr by spectrophotometric analysis
- ChEBML_223445 Inhibition of human pp60c-src SH3-SH2 domain binding to autophosphorylated EGFR.
- ChEBML_52037 Binding affinity for Cys188Ala Src SH2 domain mutant using BIAcore binding assay
- ChEMBL_1445043 (CHEMBL3372975) Inhibition of Src (unknown origin) in presence of 1 mM ATP
- ChEMBL_1451681 (CHEMBL3366512) Inhibition of c-Src (unknown origin) after 60 mins by ELISA
- ChEMBL_202594 (CHEMBL806418) Binding affinity against Src SH2 domain in competitive fluorescence polarization assay
- ChEMBL_216865 (CHEMBL816864) Inhibition of c-Src tyrosine kinase against 100 uM cdc2 substrate
- ChEMBL_221654 (CHEMBL823231) Inhibitory concentration against SH2 domain of human p60 Src tyrosine kinase
- ChEMBL_2267415 Inhibition of human SRC incubated for 40 mins by scintillation counter analysis
- ChEMBL_2543585 Inhibition of human SRC assessed as inhibition constant in presence of ATP
- ChEMBL_2565099 Inhibition of SRC (unknown origin) Lys1 labeling site by KiNativ Profiling analysis
- ChEMBL_325117 (CHEMBL861049) Average Binding Constant for SRC; NA=Not Active at 10 uM
- ChEMBL_389341 (CHEMBL869827) Inhibition of human recombinant Src in presence of 10 mM ATP
- ChEMBL_509001 (CHEMBL1006342) Inhibition of Tel-fused SRC kinase-mediated mouse BaF3 cell proliferation
- ChEMBL_542407 (CHEMBL1010644) Binding affinity to Shc Src homology 2 domain by fluorescence anisotropy
- ChEMBL_631356 (CHEMBL1105693) Inhibition of human recombinant Src after 70 mins by FRET assay
- ChEMBL_659673 (CHEMBL1246095) Inhibition of GST-tagged recombinant Src after 20 mins by autoradiography
- ChEMBL_748814 (CHEMBL1781662) Inhibition of c-Src using AEEEIYGEFEAKKKK substrate by fluorescence intensity assay
- ChEMBL_622389 (CHEMBL1100196) Inhibition of HIV1 TAT transfected to human HeLa cells assessed as decrease in luminescence after 48 hrs by duel luciferase reporter gene assay
- ChEBML_202627 Inhibitory activity against cellular Src protein tyrosine kinase using the actin ring assay
- ChEBML_217001 Tested for inhibition of protein tyrosine kinase c-Src phosphorylation in intact cells
- ChEBML_221788 Binding affinity for p60 c-Src SH2 domain by scintillation proximity assay (SPA)
- ChEMBL_1546449 (CHEMBL3748640) Inhibition of human c-Src using poly[Glu:Tyr] (4:1) as substrate
- ChEMBL_1586056 (CHEMBL3820673) Inhibition of SRC (unknown origin) incubated for 1 hr by spectrophotometric analysis
- ChEMBL_1658134 (CHEMBL4007746) Inhibition of SRC (unknown origin) after 60 mins by TR-FRET assay
- ChEMBL_202773 (CHEMBL808768) Binding affinity for Src SH2 domain in scintillation proximity binding assay (SPA)
- ChEMBL_2130171 (CHEMBL4839600) Inhibition of human recombinant Src (1-530) by radiometric scintillation counting analysis
- ChEMBL_216577 (CHEMBL818888) Binding affinity for wild type Src SH2 domain using BIAcore binding assay
- ChEMBL_306718 (CHEMBL831481) Inhibition of fluorescent (GpYEEI) binding to Src protein tyrosine kinase SH2 domain
- ChEMBL_52037 (CHEMBL665626) Binding affinity for Cys188Ala Src SH2 domain mutant using BIAcore binding assay
- ChEMBL_654587 (CHEMBL1243631) Inhibition of human GST-fused Src-mediated Poly Glu4Tyr phosphorylation by ELISA
- ChEMBL_952142 (CHEMBL2350669) Inhibition of SRC (unknown origin) after 10 mins by mobility shift assay
- ChEMBL_972664 (CHEMBL2410767) Inhibition of c-Src (unknown origin) after 10 mins by fluorimetric assay
- ChEMBL_1850991 (CHEMBL4351615) Inhibition of FITC-labeled Tat peptide binding to GST-fused PCAF bromodomain (719 to 832 residues) (unknown origin) after 6 hrs by fluorescence polarization assay
- ChEBML_154591 Inhibition of [35S]-labeled SH2-GST Src binding to phospho-PDGF receptor intracellular domain
- ChEBML_202617 In vitro inhibition of Src protein tyrosine kinase using the Scintillation proximity kinase assay.
- ChEBML_202782 Inhibition of [125I]-labeled phosphopeptide binding to a Src protein tyrosine kinase SH2 domain.
- ChEMBL_1500407 (CHEMBL3587040) Inhibition of SRC (unknown origin) using ATP and polyE4Y substrate by radiometric assay
- ChEMBL_1619706 (CHEMBL3861875) Inhibition of human SRC by time-resolved fluorescence or time-resolved fluorescence assay
- ChEMBL_2015047 (CHEMBL4668625) Inhibition of c-Src (unknown origin) using biotin-KVEKIGEGTYGVVYK as substrate by ELISA
- ChEMBL_202627 (CHEMBL805372) Inhibitory activity against cellular Src protein tyrosine kinase using the actin ring assay
- ChEMBL_226201 (CHEMBL843327) Inhibition of v-Src tyrosine kinase autophosphorylation in SR3Y1 cells after 15 hr
- ChEMBL_748925 (CHEMBL1781373) Inhibition of Src assessed as biotin-EGPWLEEEEEAYGWMDF peptide phosphorylation by TR-FRET assay
- ChEMBL_790780 (CHEMBL1926233) Inhibition of recombinant human SRC using poly(Glu,Tyr)4:1 as substrate
- ChEMBL_853585 (CHEMBL2154040) Inhibition of recombinant Src catalytic domain in presence of 1 uM radiolabeled ATP
- In Vitro Kinase Assay In vitro kinase assay using Abl, Abl T315I or Src kinase.
- Kinase Inhibition Assay Inhibition of human Src kinase activity by ARIAD compounds were measured in a homogeneous time-resolved fluorescence resonance energy transfer (TR-FRET) assay using human pp60 c-Src from a upstate Biotechnology.
- Src Inhibition Assay IC50 is the inhibitor concentration, which inhibits 50% of pp60c-src activity that catalyzes the transfer of the terminal phosphate from [gamma-32P] labeled ATP to a synthetic gastrin-based peptide substrate.
- ChEBML_202610 Inhibition of Src protein tyrosine kinase activity with 1 mM ATP and biotinylated lck peptide
- ChEMBL_1434283 (CHEMBL3385828) Inhibition of wild type SRC (unknown origin) incubated for 5 mins by HTRF assay
- ChEMBL_154591 (CHEMBL762577) Inhibition of [35S]-labeled SH2-GST Src binding to phospho-PDGF receptor intracellular domain
- ChEMBL_1815514 (CHEMBL4315088) Inhibition of recombinant human full length His-tagged Src expressed in baculovirus expression system
- ChEMBL_1842128 (CHEMBL4342555) Inhibition of SRC in transformed mouse NIH3T3 cells by SDS-PAGE based immunoblot assay
- ChEMBL_1922384 (CHEMBL4425340) Inhibition of chicken Src kinase domain using AEEEIYGEFAKKK as substrate by continuous spectrophotometric assay
- ChEMBL_202617 (CHEMBL805362) In vitro inhibition of Src protein tyrosine kinase using the Scintillation proximity kinase assay.
- ChEMBL_221659 (CHEMBL823236) Inhibition of p60 c-Src tyrosine kinase mediated phosphorylation of Fak in IC8.1 fibroblasts
- ChEMBL_226200 (CHEMBL843326) Inhibition of v-Src tyrosine kinase autophosphorylation in SR3Y1 cells after 15 hr exposure
- ChEMBL_2330979 Inhibition of SRC (unknown origin) using ATP as substrate incubated for 1 hrs by ELISA
- ChEMBL_2515702 Binding affinity to human SRC incubated for 45 mins by Kinobead based pull down assay
- ChEMBL_526200 (CHEMBL974769) Inhibition of His-tagged human src kinase expressed in Sf9 cells by DELFIA assay
- ChEMBL_63766 (CHEMBL677208) Inhibition of Epidermal growth factor receptor activity against tripeptide RR-Src at 10 uM
- ChEMBL_762506 (CHEMBL1816876) Inhibition of recombinant SRC assessed as 33Pi incorporation after 60 mins by scintillation counting
- ChEMBL_773571 (CHEMBL1839937) Inhibition of SRC-mediated proliferation of mouse BAF3 cells transformed with TEL-Kinase construct
- ChEMBL_795546 (CHEMBL1935924) Inhibition of mouse Sky kinase assessed as inhibition of src substrate phosphorylation by ELISA
- ChEMBL_886108 (CHEMBL2210030) Inhibition of GST-tagged c-Src preincubated for 30 mins measured after 60 mins
- ChEMBL_1515075 (CHEMBL3614119) Inhibition of APOBEC3G (unknown origin) using ssDNA oligomer 5'-6-FAM-AAA-TAT-TCC-CTA-ATA-GAT-AAT-GTG-A-TAMRA-3' by fluorescence-based deamination assay
- ChEMBL_1515076 (CHEMBL3614120) Inhibition of APOBEC3G (unknown origin) using ssDNA oligomer 5'-6-FAM-AAA-TAT-TCC-CTA-ATA-GAT-AAT-GTG-A-TAMRA-3' by fluorescence-based deamination HTS assay
- ChEBML_90526 Concentration required for inhibition of c-Src mediated phosphorylation of Fak in IC8.1 fibroblast cell assay
- ChEMBL_1628685 (CHEMBL3871311) Inhibition of recombinant human Src using KVEKIGEGTYGVVYK as substrate by [gamma-32P]ATP based assay
- ChEMBL_1691362 (CHEMBL4042011) Inhibition of recombinant c-Src (unknown origin) after 120 mins in presence of [33P]ATP
- ChEMBL_202774 (CHEMBL809531) Binding affinity for Src protein tyrosine kinase SH2 domain using surface plasmon resonance (SPR) assay
- ChEMBL_202775 (CHEMBL809532) Binding affinity for Src protein tyrosine kinase SH2 domain using scintillation proximity binding assay (SPA)
- ChEMBL_202776 (CHEMBL809533) Binding affinity for Src protein tyrosine kinase SH2 domain using surface plasmon resonance (SPR) assay
- ChEMBL_202778 (CHEMBL809535) Binding affinity towards Src protein tyrosine kinase SH2 domain using scintillation proximity binding assay (SPA)
- ChEMBL_202779 (CHEMBL873263) Binding affinity towards Src protein tyrosine kinase SH2 domain using surface plasmon resonance (SPR) assay
- ChEMBL_2169144 (CHEMBL5054203) Inhibition of human full length SRC expressed in baculovirus expression system by mobility shift assay
- ChEMBL_2196458 (CHEMBL5108974) Inhibition of recombinant SRC (unknown origin) in presence of [33P]-ATP by kinase hotspot assay
- ChEMBL_2517370 Inhibition of SRC (unknown origin) assessed as reduction in phosphorylated FAK level by cell based assay
- ChEMBL_304408 (CHEMBL831813) Effective concentration for recruitment of SRC-1 LxxLL-containing peptide to human Farnesoid X receptor
- ChEMBL_753991 (CHEMBL1798374) Inhibition of SRC assessed as incorporation of p33 using [gammaP33]-ATP by microplate scintillation counting
- ChEMBL_827265 (CHEMBL2050664) Inhibition of Src using ATP preincubated with compound for 5 mins measured after 10 mins
- ChEMBL_947987 (CHEMBL2344637) Inhibition of Src (unknown origin) using [gamma-33P]ATP after 30 mins by radiometric assay
- Kinase Assay 2,6,9-Trisubstituted purines were evaluated for their src kinase inhibitory activities using an ELISA assay.
- ChEMBL_1850993 (CHEMBL4351617) Inhibition of biotinylated Tat-AcK50 binding to GST-fused PCAF bromodomain (719 to 832 residues) (unknown origin) expressed in Escherichia coli BL21(DE3) measured after overnight incubation by ELISA
- ChEMBL_1477873 (CHEMBL3429152) Inhibition of human c-Src using poly[Glu:Tyr] (4:1) peptide substrate by 33P Hotspot assay
- ChEMBL_1557117 (CHEMBL3773069) Inhibition of human SRC using Ac-EIYGEFKKK as substrate after 90 mins by luciferase reporter assay
- ChEMBL_1563171 (CHEMBL3784000) Inhibition of full length recombinant human C-terminal His-tagged SRC expressed in Baculovirus expression system
- ChEMBL_202777 (CHEMBL809534) Binding affinity towards Src protein tyrosine kinase SH2 domain protein using scintillation proximity binding assay (SPA)
- ChEMBL_2185238 (CHEMBL5097320) Irreversible inhibition of wild type c-Src (unknown origin) assessed as inhibition constant by fluorimetric assay
- ChEMBL_536773 (CHEMBL984567) Inhibition of estradiol-induced coactivator peptide SRC binding to recombinant estrogen receptor by fluorescence polarization assay
- ChEMBL_598137 (CHEMBL1039167) Inhibition of human Src expressed in rat fibroblasts assessed as anchorage independent growth after 3 days
- ChEMBL_801287 (CHEMBL1947836) Partial agonist activity at human PPARgamma LBD assessed as activation of Src-1 by HTRF assay
- ChEMBL_863005 (CHEMBL2175185) Binding affinity to STAT3 SH2 in v-Src transformed mouse NIH/3T3 cells overexpressing human EGFR
- ChEMBL_90527 (CHEMBL700597) Concentration required for inhibition of c-Src mediated phosphorylation of Fak in IC8.1 fibroblast cell assay
- ChEMBL_1438919 (CHEMBL3382430) Inhibition of Src (unknown origin) expressed in HEK293 cells assessed as decrease in phosphorylation by chemiluminescence assay
- ChEMBL_1477086 (CHEMBL3428253) Inhibition of Src phosphorylation in human MDA-MB-231 cells after 20 hrs by Western blot analysis
- ChEMBL_1495742 (CHEMBL3578905) Competitive binding affinity to SRC in human A375 cells after 15 mins in presence of ATP analogue
- ChEMBL_1518812 (CHEMBL3625486) Inhibition of recombinant Src (unknown origin) using fluoresceinated peptide as substrate after 60 mins by HTRF assay
- ChEMBL_1622697 (CHEMBL3865049) Inhibition of human SRC using Ac-EIYGEFKKK as substrate after 90 mins by Kinase glo luciferase assay
- ChEMBL_1721609 (CHEMBL4136609) Inhibition of recombinant SRC (unknown origin) using polyE4Y as substrate by pyruvate kinase-lactate dehydrogenase coupled assay
- ChEMBL_1828454 (CHEMBL4328328) Inhibition of human c-SRC using poly[Glu:Tyr] (4:1) as substrate by [gamma-33P]-ATP assay
- ChEMBL_1934128 (CHEMBL4479780) Inhibition of full-length recombinant human His-tagged SRC expressed in baculovirus expression system by Adapta assay
- ChEMBL_2014144 (CHEMBL4667722) Binding affinity to T7-tagged Src (unknown origin) expressed in Escherichia coli BL21 incubated for 1 hr
- ChEMBL_2065565 (CHEMBL4720818) Inhibition of human c-SRC using poly[Glu:Tyr] (4:1) as substrate by [gamma-33P]-ATP assay
- ChEMBL_2066524 (CHEMBL4721777) Binding affinity to human SRC using poly[Glu:Tyr] (4:1) as substrate by radiometric hotspot kinase assay
- ChEMBL_2326400 Activation of GST-tagged FXR LBD (unknown origin) using biotinylated Src-1 peptide as substrate by AlphaScreen assay
- ChEMBL_2375700 Binding affinity to Src (unknown origin) assessed as inhibition constant in presence of ATP by competitive binding assay
- ChEMBL_2573575 Inhibition of recombinant SRC (unknown origin) preincubated for 1 hr in presence of ATP by Z-Lyte assay
- ChEMBL_631357 (CHEMBL1105694) Inhibition of Src-mediated cell proliferation in rat Rat-2 fibroblasts after 4 days by MTS assay
- ChEMBL_834203 (CHEMBL2072943) Inhibition of human SRC using Ac-EIYGEFKKK-OH as substrate after 60 mins by phosphor imaging method
- ChEMBL_886726 (CHEMBL2209626) Inhibition of recombinant SRC after 1 hr by scintillation counter analysis in presence of gamma-[33P]ATP
- ChEMBL_887651 (CHEMBL2217260) Inhibition of chicken c-Src using IYGEFKKK peptide as a substrate and [32P]ATP by fluorescence analysis
- ChEMBL_1663822 (CHEMBL4013503) Inhibition of human wild type full length N-terminal GST/6His-tagged SRC (M1 to L536 residues) expressed in baculovirus infected Sf9 cells using src peptide as substrate after 5 mins in presence of [gamma-32P]ATP by scintillation counting method
- ChEMBL_1722804 (CHEMBL4137804) Transactivation of VP16-tagged VDR (unknown origin) expressed in HEK293 cells harboring pCMX-GAL4-SRC-1 and MH100(UAS) X 4tk-LUC reporter plasmid assessed as increase in SRC-1 recruitment by beta-galactosidase reporter gene based mammalian two-hybrid assay
- ChEBML_202783 The compound was evaluated for its binding affinity towards phosphotyrosine binding pocket of Src protein tyrosine kinase SH2 domain
- ChEBML_221672 Inhibition of p60 c-Src tyrosine kinase enzyme activity in liquid-phase tyrosine phosphorylation assay at 830 ng/mL
- ChEBML_72366 Inhibitory concentration required against Src homology (SH2) domain of Growth factor receptor bound protein 2 by ELISA binding assay
- ChEMBL_1521054 (CHEMBL3624485) Inhibition of recombinant Src (unknown origin) after 40 mins by scintillation counting analysis in presence of [gamma33P]-ATP
- ChEMBL_1633259 (CHEMBL3876051) Inhibition of human recombinant full length C-terminal His-tagged SRC cytoplasmic domain expressed in baculovirus expression system
- ChEMBL_1732108 (CHEMBL4147644) Inhibition of Src (unknown origin) using poly (Glu,Tyr) 4:1 as substrate after 1 hr by ELISA
- ChEMBL_1796639 (CHEMBL4268756) Inhibition of human c-Src using KVEKIGEGTYGVVYK as substrate in presence of [gamma32P]ATP by scintillation counting method
- ChEMBL_1979910 (CHEMBL4613045) Inhibition of human NMT1 using p60 SRC(2 to 16) as substrate by CPM dye based fluorescence assay
- ChEMBL_202793 (CHEMBL809573) Inhibitory activity against binding of Src protein tyrosine kinase SH2 domain to biotinylated EPQY*EEIPI Peptide by ELISA.
- ChEMBL_221796 (CHEMBL843190) Inhibition of in vitro protein-tyrosine kinase activity of p60v-src enzyme in presence of 5 uM ATP.
- ChEMBL_2283231 Inhibition of Src kinase (unknown origin) phosphorylation at Tyr416/419 residues incubated for 24 hrs by Western blot analysis
- ChEMBL_2336402 Inhibition of recombinant c-Src (unknown origin) incubated for 120 mins in presence of [33P]-ATP by hotspot assay
- ChEMBL_2542983 Inhibition of recombinant SRC (unknown origin) incubated for 60 mins in presence of ATP by electrophoretic caliper fluorescence analysis
- ChEMBL_1364567 (CHEMBL3295622) Inhibition of recombinant c-Src (unknown origin) using poly (4 Glu, Tyr) as substrate after 60 mins by ELISA
- ChEMBL_1550525 (CHEMBL3762063) Inhibition of recombinant human c-Src using poly (Glu,Tyr)4:1 as substrate after 60 mins by ELISA
- ChEMBL_1590291 (CHEMBL3830183) Inhibition of recombinant human c-Src using poly (Glu, Tyr) 4:1 as substrate after 60 mins by ELISA
- ChEMBL_1623200 (CHEMBL3865552) Inhibition of N-terminal His6-tagged recombinant human Src (1 to 530 residues) expressed in baculovirus infected sf21 cells
- ChEMBL_202788 (CHEMBL808042) Binding affinity for Src protein tyrosine kinase SH2 domain using fluorescence polarization assay with 20% DMSO in buffer solution
- ChEMBL_2185236 (CHEMBL5097318) Binding affinity to chicken 6-His tagged c-Src expressed in Escherichia coli Bl21 (DE3) assessed as dissociation constant
- ChEMBL_221672 (CHEMBL822437) Inhibition of p60 c-Src tyrosine kinase enzyme activity in liquid-phase tyrosine phosphorylation assay at 830 ng/mL
- ChEMBL_63765 (CHEMBL677207) In vitro inhibition of intrinsic tyrosine protein kinase activity of the Epidermal growth factor receptor using tripeptide RR-Src
- ChEMBL_743061 (CHEMBL1768532) Inhibition of c-SRC assessed as residual activity using KVEKIGEGYYGVVYK as peptide substrate after 20 mins by scintillation counting
- ChEMBL_824243 (CHEMBL2044298) Inhibition of SRC incubated for 30 mins prior to substrate addition study done at apparent ATP Km for enzyme
- Z'-Lyte assaytion Assay The enzymatic activities SRC are tested in Z'-Lyte assays with ATP concentrations of Km (50 uM)
- ChEMBL_1330629 (CHEMBL3222534) Agonist activity at zebrafish VDR LBD assessed as binding affinity to TAMRA-labeled SRC-1 peptide by fluorescence anisotropy assay
- ChEMBL_1461196 (CHEMBL3395759) Inhibition of human recombinant src kinase using KVEKIGEGTYGVVYK as substrate by filter binding assay in presence of [gamma-32P]ATP
- ChEMBL_1622560 (CHEMBL3864912) Inhibition of recombinant c-Src (unknown origin) using poly (Glu,Tyr)4:1 as substrate after 60 mins by ELISA
- ChEMBL_1653408 (CHEMBL4002774) Inhibition of recombinant c-Src (unknown origin) using poly (Glu,Tyr) 4:1 as substrate after 60 mins by ELISA
- ChEMBL_1654852 (CHEMBL4004218) Inhibition of recombinant full length human N-terminal GST-tagged SRC (1 to 536 residues) expressed in baculovirus expression system
- ChEMBL_1668748 (CHEMBL4018636) Inhibition of recombinant c-Src (unknown origin) using poly (Glu,Tyr) 4:1 as substrate after 60 mins by ELISA
- ChEMBL_1802631 (CHEMBL4274923) Inhibition of Fyn (unknown origin) using Src-family kinase bisamide rhodamine 110 peptide substrate after 1 hr by fluorescence assay
- ChEMBL_1802632 (CHEMBL4274924) Inhibition of Lyn (unknown origin) using Src-family kinase bisamide rhodamine 110 peptide substrate after 1 hr by fluorescence assay
- ChEMBL_1830443 (CHEMBL4330451) Inhibition of c-Src (unknown origin) using FAM-labelled peptide and ATP incubated for 10 mins by mobility shift assay
- ChEMBL_1881354 (CHEMBL4382853) Inhibition of recombinant c-SRC (unknown origin) using poly (Glu,Tyr) 4:1 as substrate after 60 mins by ELISA
- ChEMBL_1891468 (CHEMBL4393295) Inhibition of c-SRC (unknown origin) using FAM-labelled peptide as substrate measured after 10 mins by mobility shift assay
- ChEMBL_1928611 (CHEMBL4431787) Inhibition of chicken Src using AcEIYGEFKKK as substrate after 90 mins in presence of ATP by luciferase reporter gene assay
- ChEMBL_2054112 (CHEMBL4709113) Inhibition of c-Src (unknown origin) using FAM-labelled peptide and ATP incubated for 10 mins by mobility shift assay
- ChEMBL_2373260 Inhibition of human wild type partial length Src kinase (L240 to L536 residues) expressed in bacterial expression system by KINOMEscan analysis
- ChEMBL_789721 (CHEMBL1924891) Inhibition of N-terminus flag-tagged Src expressed in baculovirus infected insect cells using ATP as substrate after 10 mins
- ChEMBL_1838766 (CHEMBL4338899) Allosteric inhibition of recombinant His6-tagged RORgammat LBD (unknown origin) expressed in Escherichia coli BL21(DE3) assessed as inhibition of biotin-labelled SRC-1 peptide recruitment preincubated for 15 mins followed by biotin-labelled SRC-1 peptide addition and measured after overnight incubation by TR-FRET assay
- ChEMBL_1895070 (CHEMBL4397105) Activation of Tat-mediated HIV1 transcription in J-Lat 10.6 cells harboring LTR driven GFP reporter co-expressing CMV driven RFP reporter assessed as LTR-driven gene expression incubated for 48 hr by FACSCalibur flow cytometry
- ChEMBL_1497041 (CHEMBL3580016) Inhibition of human recombinant full-length Fyn using Src substrate peptide after 15 mins incubation by MicroBeta liquid scintillation counting analysis
- ChEMBL_202787 (CHEMBL808041) Binding affinity was determined on Src protein tyrosine kinase SH2 domain using fluorescence polarization assay with 2% DMSO in buffer solution
- ChEMBL_2110961 (CHEMBL4819811) Agonist activity at APC-labelled RORgammat (unknown origin) assessed as biotinylated SRC recruitment measured after 1 hr by dual FRET assay
- ChEMBL_2158488 (CHEMBL5043238) Binding affinity to wild-type human partial length SRC (L240 to L536 residues) expressed in bacterial expression system by Kinomescan method
- ChEMBL_216862 (CHEMBL816861) In vitro inhibition of the c-src tyrosine kinase activity in A431 membranes using angiotensin II as phosphate acceptor as substrate
- ChEMBL_2237720 (CHEMBL5151616) Inhibition of c-SRC in human MDA-MB-468 cells in presence of [gamma-32P]ATP and ATP by immunoprecipitation method
- ChEMBL_2243100 (CHEMBL5157310) Agonist activity at FXR-LBD (unknown origin) assessed as induction of coactivator SRC-1 peptide recruitment measured by TR-FRET assay
- ChEMBL_2567810 Inhibition of human SRC T341M mutant using poly (Glu, Tyr)4:1 as substrate in presence of [gamma33P]-ATP by HotSpot assay
- ChEMBL_2578625 Inhibition of GST tagged Src (unknown origin) assessed as inhibition of phosphorylation preincubated for 5 mins followed by [gamma-32P]ATP addition
- ChEMBL_1813501 (CHEMBL4313075) Inhibition of human c-Src using poly (Glu, Tyr)4:1 as substrate measured after 60 mins by ELISA relative to control
- ChEMBL_1870009 (CHEMBL4371176) Inhibition of human c-SRC expressed in mouse NIH/3T3 cells assessed as inhibition of cell growth in presence of 0.5% FCS
- ChEMBL_1870013 (CHEMBL4371180) Inhibition of human c-SRC expressed in mouse NIH/3T3 cells assessed as reduction in BrdU incorporation after 24 hrs by ELISA
- ChEMBL_1922038 (CHEMBL4424883) Inhibition of human full-length N-terminal His6-tagged Fyn expressed in baculovirus infected Sf21 insect cells using Src peptide as substrate
- ChEMBL_1922045 (CHEMBL4424890) Inhibition of full-length human N-terminal His6-tagged LCK expressed in baculovirus infected Sf21 insect cells using Src peptide as substrate
- ChEMBL_1973664 (CHEMBL4606482) Inhibition of human Src expressed in Escherichia coli BL21 using Abltide peptide as substrate incubated for 20 to 40 mins by ELISA
- ChEMBL_2026867 (CHEMBL4681025) Agonist activity at glutathione transferase-tagged human FXR-LBD using biotinylated Src-1 peptide incubated for 30 mins by recruitment coactivator assay
- ChEMBL_217006 (CHEMBL821541) Concentration of compound required for inhibiting the binding of the fluorescent probe to the c-Src tyrosine kinase SH2 domain by 50%
- ChEMBL_2374882 Agonist activity at GST-tagged FXR (unknown origin) assessed as increase in recruitment of co-activator SRC-2 by LanthaScreen TR-FRET assay
- ChEMBL_776799 (CHEMBL1913896) Inhibition of c-Src using biotinylated substrate preincubated for 15 mins before substrate addition measured after 30 mins by fluorescence microplate analysis
- ChEMBL_811222 (CHEMBL2015057) Inhibition of SRC using poly(Glu,Tyr) as substrate assessed as [33P-gamma]-ATP incorporation after 60 mins by microplate scintillation counting
- ChEMBL_968429 (CHEMBL2400580) Agonist activity at GST-tagged human FXR LBD assessed as recruitment of biotinylated SRC-1 peptide after 30 mins by AlphaScreen assay
- ChEMBL_1933594 (CHEMBL4479246) Agonist activity at human oxytocin receptor expressed in HEK293 cells coexpressing Rluc8-tagged Galphaq, N-terminal GFP-tagged Ggamma2 and Gbeta1 protein incubated for 2 mins in presence of TMH1-TAT peptide by Gq protein activation based BRET assay
- ChEMBL_1933595 (CHEMBL4479247) Agonist activity at human oxytocin receptor expressed in HEK293 cells coexpressing Rluc8-tagged Galphaq, N-terminal GFP-tagged Ggamma2 and Gbeta1 protein incubated for 2 mins in presence of TMH5-TAT peptide by Gq protein activation based BRET assay
- ChEMBL_1368555 (CHEMBL3300697) Inhibition of Src (unknown origin) assessed as incorporation of [32P] gamma-ATP in to myelin basic protein after 30 mins by autoradiographic analysis
- ChEMBL_1545651 (CHEMBL3749489) Agonist activity at recombinant His-tagged human FXR ligand binding domain assessed as SRC-1 coactivator recruitment after 4 hrs by luminescence analysis
- ChEMBL_1730648 (CHEMBL4146184) Agonist activity at GST-tagged FXR-LBD (unknown origin) assessed as biotin-labeled SRC-1 recruitment after 30 mins by Alpha Screen assay
- ChEMBL_1774164 (CHEMBL4231156) Inhibition of recombinant human Src using Ulight-Poly GAT[EAY(1:1:1)]n as substrate measured after 10 mins by LANCE assay
- ChEMBL_1799431 (CHEMBL4271723) Inhibition of recombinant c-Src (unknown origin) using poly (Glu, Tyr) 4:1 as substrate after 60 mins by ELISA based spectrophotometric method
- ChEMBL_1869357 (CHEMBL4370423) Agonist activity at His-tagged human RORgammaT assessed as induction of biotinylated SRC-1 peptide recruitment after 1 hr by TR-FRET assay
- ChEMBL_1877816 (CHEMBL4379210) Inhibition of recombinant human C-Src using KVEKIGEGTYGVV as substrate incubated 40 mins in presence of [gamma-33ATP] by radiometric scintillation counting analysis
- ChEMBL_1878213 (CHEMBL4379607) Inhibition of human C-src using poly (Glu,Tyr) 4:1 as substrate in presence of 33P-gamma ATP by hotspot kinase assay
- ChEMBL_1909792 (CHEMBL4412238) Inhibition of SRC (unknown origin) preincubated for 10 mins followed by substrate addition and measured after 1 hr by ADP-Glo luminescence assay
- ChEMBL_198453 (CHEMBL807493) Radioligand displacement assay for the binding of [125I]Glu-Pro-Gln-pTyr-Glu-Glu-Ile-Pro-Ile-Tyr-Leu to SRC SH2 domain
- ChEMBL_1995688 (CHEMBL4629583) Agonist activity at GFP RXRalpha LBD (unknown origin) assessed as biotin-labeled SRC-1 recruitment incubated for 2 hrs by HT-FRET assay
- ChEMBL_2065004 (CHEMBL4720257) Inhibition of recombinant human SRC using Ulight-Poly GAT[EAY(1:1:1)]n as substrate incubate for 10 mins by LANCE assay
- ChEMBL_2287259 Agonist activity at human FXR expressed in Escherichia coli BL21 (DE3) assessed as effect on europium labeled SRC-1 peptide recruitment by HTRF assay
- ChEMBL_2516900 Inhibition of glutathione S-transferase fused c-Src (unknown origin) catalytic activity infected in Sf9 cells using poly-Glu-Tyr (4:1) as substrate
- ChEMBL_808134 (CHEMBL1960851) Inhibition of human recombinant SRC expressed in Sf9 cells using poly(E,Y)4:1 as substrate after 80 mins by scintillation counting
- ChEMBL_822295 (CHEMBL2038598) Agonist activity at human GST-tagged FXR ligand binding domain assessed as recruitment of Src-1 peptide after 30 mins by AlphaScreen assay
- ChEMBL_1895052 (CHEMBL4397087) Activation of Tat-mediated HIV1 transcription in HEK293-FlpIn.RV cells harboring LTR driven CBG reporter co-expressing CMV driven CBR reporter assessed as LTR-driven gene expression incubated for 48 hr using Chroma-Glo substrate by luciferase dual reporter cellular assay
- ChEMBL_988290 (CHEMBL2439744) Inhibition of CCR5 (unknown origin) expressed in human HeLa cells assessed as inhibition of interaction of CHO cells expressing HIV-1 JRFLenv and HIV-1 Tat and human HeLa cells expressing CD4 after 20 hrs by beta-galactosidase reporter gene assay
- ChEMBL_1835643 (CHEMBL4335776) Inhibition of recombinant full-length human SRC using KVEKIGEGTYGVVYK as substrate measured after 40 mins in presence of [gamma33P]ATP by scintillation counting analysis
- ChEMBL_1870012 (CHEMBL4371179) Inhibition of human recombinant pp60c-src expressed in baculovirus infected Sf9 insect cells using poly(Glu,Tyr) 4:1 as substrate after 15 mins
- ChEMBL_1902709 (CHEMBL4404931) Agonist activity at His-tagged PXR-LBD/SRC-1p (unknown origin) expressed in Escherichia coli BL21(DE3) by coactivator recruitment based Alpha-screen assay
- ChEMBL_1972846 (CHEMBL4605664) Inhibition of SRC (unknown origin) assessed as residual activity incubated for 5 mins in presence of [gamma-33ATP] by scintillation counting based radiometry assay
- ChEMBL_1986202 (CHEMBL4619608) Inhibition of human c-SRC using poly(Glu,Tyr)4:1 substrate and [gamma-33P]-ATP incubated for 40 mins by scintillation counting method
- ChEMBL_2110967 (CHEMBL4819817) Inverse agonist activity at APC-labelled RORgammat (unknown origin) assessed as inhibition of biotinylated SRC recruitment measured after 1 hr by dual FRET assay
- ChEMBL_2114667 (CHEMBL4823608) Inhibition of recombinant human C-Src using KVEKIGEGTYGVVYK as substrate incubated 40 mins in presence of [gamma-33ATP] by scintillation counting based radiometry assay
- ChEMBL_2125053 (CHEMBL4834286) Inhibition of SRC (unknown origin) expressed in mouse BaF3 cells assessed as reduction in cell proliferation incubated for 48 hrs by cell proliferation assay
- ChEMBL_2455923 Inhibition of human recombinant c-SRC catalytic domain using pEY (4:1) as substrate incubated for 30 mins in presence of ATP by ELISA method
- ChEMBL_2512813 Displacement of kinase tracer 236 from GST-tagged SRC (unknown origin) assessed as inhibition constant incubated for 1 hr by HTRF based TR-FRET assay
- ChEMBL_2527354 Inhibition of SRC (unknown origin) in presence of ATP Km treated at 2 hrs followed by IGF1 ligand addition for 15 mins by ELISA analysis
- ChEMBL_830883 (CHEMBL2065432) Agonist activity at GST-tagged FXR-LBD using biotinylated-SRC-1 peptide as substrate preincubated with compound for 30 mins measured after 4 hrs
- ChEBML_1572579 Inhibition of full length N-terminal His-tagged recombinant human SRC preincubated for 5 mins measured after 10 mins in presence of ATP by AlphaScreen assay
- ChEMBL_1514163 (CHEMBL3614606) Antagonist activity at GST-tagged FXR LBD (unknown origin) assessed as inhibition of CDCA-induced Bio-SRC-1 recruitment after 30 mins by HTRF assay
- ChEMBL_1580745 (CHEMBL3811350) Inhibition of human SRC (1 to 530 residues) using GGEEEEYFELVKKKK as substrate after 40 mins by scintillation counting analysis in presence of [gamma-33P-ATP]
- ChEMBL_1589293 (CHEMBL3830423) Inhibition of recombinant human c-Src expressed in insect Sf9 cells using poly(Glu,Tyr)4:1 as substrate incubated for 60 mins by ELISA
- ChEMBL_2116567 (CHEMBL4825508) Agonist activity at His-tagged human FXR LBD assessed as induction of coactivator SRC-1 peptide recruitment measured after 30 mins by plate reader analysis
- ChEMBL_750624 (CHEMBL1785470) Inhibition of SRC catalytic domain assessed as inhibition of [gamma-33P]ATP incorporation into Ac-EIYGEFKKK-OH substrate after 30 mins by phosphor imaging analysis
- ChEMBL_752089 (CHEMBL1786253) Inhibition of c-Src expressed in Bac-to-Bac Baculovirus expression system using poly(Glu-Tyr)4:1 as substrate after 60 mins by ELISA
- ChEMBL_1895051 (CHEMBL4397086) Activation of Tat-mediated HIV1 transcription in HEK293- FlpIn-FM cells harboring LTR driven CBR reporter co-expressing CMV driven CBG reporter assessed as LTR-driven gene expression incubated for 48 hr using Chroma-Glo substrate by luciferase dual reporter cellular assay
- ChEMBL_1933602 (CHEMBL4479254) Agonist activity at human oxytocin receptor high affinity site expressed in HEK293 cells coexpressing Rluc8-tagged Galphaq, N-terminal GFP-tagged Ggamma2 and Gbeta1 protein incubated for 2 mins in presence of TMH5-TAT peptide by Gq protein activation based BRET assay
- ChEMBL_1933603 (CHEMBL4479255) Agonist activity at human oxytocin receptor low affinity site expressed in HEK293 cells coexpressing Rluc8-tagged Galphaq, N-terminal GFP-tagged Ggamma2 and Gbeta1 protein incubated for 2 mins in presence of TMH5-TAT peptide by Gq protein activation based BRET assay
- In Vitor Src Tyrosine Kinase Activity Assay Kinase activity (Src-family kinases, Hck, Lyn, Fyn, and c-Src) and the effect of the molecules were determined by ProFluor Src-Family Kinase Assay Kit (Promega). A titration assay was performed for each kinase to determine the amount of the enzyme that results in approximately 80% phosphorylation as suggested by the manufacturer. The compounds were dissolved in 10% DMSO and tested at 1, 10 and 100 μM concentrations. Briefly, the molecules were mixed with a reaction buffer that included a specific substrate for Src-family kinases (R110), a control substrate and the kinase. The reaction was initiated by the addition of ATP. After incubating the 96-well reaction plate at 22°C for 1 h, protease solution was added to each well and the plate was incubated for 1 h. The fluorescence of the liberated R110 was read at an excitation wavelength of 485 nm and emission wavelength of 530 nm.
- ChEMBL_1774227 (CHEMBL4231219) Inhibition of recombinant human Src expressed in insect cells using Ulight-Poly GAT[EAY(1:1:1)]n as substrate after 10 mins by LANCE method
- ChEMBL_1789709 (CHEMBL4261443) Inhibition of recombinant human Src (1 to 530 residues) using GGEEEEYFELVKK as substrate after 40 mins in presence of [gamma-33P]-ATP by scintillation counting analysis
- ChEMBL_1870003 (CHEMBL4371170) Inhibition of human c-SRC expressed in mouse NIH/3T3 cells assessed as inhibition of cell growth in presence of 1.5% FCS by BrdU incorporation assay
- ChEMBL_1901877 (CHEMBL4404099) Agonist activity at GST-tagged human FXR-LBD (193 to 472 residues) using biotinylated SRC-1 peptide as substrate incubated for 1 hrs by HTRF assay
- ChEMBL_2084866 (CHEMBL4766129) Inhibition of human full length recombinant Src using Cdc2 peptide as substrate incubated for 40 mins in presence of [gamma33P-ATP] by radiometric scintillation counting analysis
- ChEMBL_2110244 (CHEMBL4818919) Inhibition of recombinant human SRC (1 to 530 residues) using GGEEEEYFELVKKKK as substrate incubated for 40 mins in presence of [gamma33P]ATP by scintillation counting method
- ChEMBL_2336406 Inhibition of recombinant GST-tagged c-Src catalytic domain (unknown origin) using pEY (4:1) as substrate incubated for 120 mins in presence of 33P-labeled ATP
- ChEMBL_2516975 Inhibition of GST tagged chicken c-Src expressed in baculovirus at pH 7.5 measured after 10 mins in presence of gamma-[33P]-ATP by scintillation counter analysis
- ChEMBL_2581623 Inhibition of SRC in human RPMI-8226 cells assessed as reduction of cell growth incubated for 72 hrs by CellTiter 96 aqueous one solution cell proliferation assay
- ChEMBL_2581938 Inhibition of Src in human ANBL-6 cells assessed as reduction of cell growth incubated for 72 hrs by CellTiter 96 aqueous one solution cell proliferation assay
- ChEMBL_2582124 Inhibition of Src in human U-266 cells assessed as reduction of cell growth incubated for 72 hrs by CellTiter 96 aqueous one solution cell proliferation assay
- ChEMBL_542408 (CHEMBL1010645) Displacement of FITC-tagged NH-(CH2)4-CO-phospho-tyrosine-glutamine-glycine-leucine-serine-amide from Shc Src homology 2 domain by fluorescence anisotropy competition assay
- ChEMBL_610372 (CHEMBL1070011) Inhibition of SHP2 Src homology-2 domain expressed in Escherichia coli BL21 (DE3) assessed as inhibition of p-nitrophenyl phosphate hydrolysis at pH 7 by spectrophotometry
- ChEMBL_610373 (CHEMBL1070012) Inhibition of SHP2 Src homology-2 domain expressed in Escherichia coli BL21 (DE3) assessed as inhibition of p-nitrophenyl phosphate hydrolysis by Lineweaver-Burke plot analysis
- ChEMBL_1766235 (CHEMBL4201482) Inhibition of HIV1 envelope glycoprotein-mediated cell-cell fusion between HL2/3 cells stably expressing HIV Gag, Env, Tat, Rev and Nef proteins and human TZM-bl cells stably expressing high CD4 and CCR5 incubated for 6 to 8 hrs by luciferase reporter assay
- ChEBML_1716392 Antagonist activity at His6-tagged ERRalpha LBD (unknown origin) assessed as inhibition of GST-tagged SRC-2 co-activator peptide recruitment after 18 hrs by TR-FRET assay
- ChEMBL_1291639 (CHEMBL3119386) Antagonist activity at GST-tagged FXRalpha LBD (unknown origin) assessed as inhibition of CDCA-induced bio-SRC-1 recruitment after 30 mins by fluorescence based HTRF assay
- ChEMBL_1498729 (CHEMBL3583142) Inhibition of Tel-fused SRC (unknown origin) expressed in mouse BA/F3 cells after 48 hrs by luciferase reporter gene assay in absence of recombinant mouse IL3
- ChEMBL_1842463 (CHEMBL4342890) Inhibition of human recombinant Src expressed in baculovirus infected Sf9 insect cells assessed as reduction in phosphorylation of polyglutamic acid/tyrosine incubated for 15 mins by ELISA
- ChEMBL_1846521 (CHEMBL4347062) Inhibition of human recombinant SRC using Ulight-Poly GAT[EAY(1:1:1) as substrate measured after 10 mins in the presence of ATP by LANCE method
- ChEMBL_1861978 (CHEMBL4362834) Agonist activity at APC-labeled biotinylated RORgammaT LBD (unknown origin) assessed as induction of biotinylated SRC-1 peptide recruitment incubated for 1 hr by dual FRET assay
- ChEMBL_1878048 (CHEMBL4379442) Inhibition of recombinant human SRC (1 to 530 residues) using GGEEEEYFELVKK as substrate incubated for 40 mins in presence of [gamma33P]ATP by radiometric scintillation counting analysis
- ChEMBL_1878049 (CHEMBL4379443) Inhibition of recombinant full length human SRC T341M mutant using GGEEEEYFELVKK as substrate incubated for 40 mins in presence of [gamma33P]ATP by radiometric scintillation counting analysis
- ChEMBL_1921999 (CHEMBL4424844) Inhibition of human full-length N-terminal His-tagged SRC expressed in baculovirus infected Sf9 insect cells using Poly-(Glu4:Tyr) as substrate measured after 35 mins
- ChEMBL_1972999 (CHEMBL4605817) Inhibition of SRC (unknown origin) transfected in mouse Ba/F3 cells assessed as reduction in cell viability incubated for 48 hrs by brightglo-luciferase reporter gene assay
- ChEMBL_2048199 (CHEMBL4702898) Agonist activity at GST-tagged human FXR LBD assessed as induction of biotinylated coactivator SRC-1 peptide recruitment measured after 2 hrs by streptavidin-conjugated AlphaScreen assay
- ChEMBL_2581610 Inhibition of Src family in human RPMI-8226 cells assessed as reduction of cell growth incubated for 72 hrs by CellTiter 96 aqueous one solution cell proliferation assay
- ChEMBL_2581882 Inhibition of Src family in human ANBL-6 cells assessed as reduction of cell growth incubated for 72 hrs by CellTiter 96 aqueous one solution cell proliferation assay
- ChEMBL_2582031 Inhibition of Src in human bortezomib-resistant ANBL6 cells assessed as reduction of cell growth incubated for 72 hrs by CellTiter 96 aqueous one solution cell proliferation assay
- ChEMBL_2582068 Inhibition of Src family in human U-266 cells assessed as reduction of cell growth incubated for 72 hrs by CellTiter 96 aqueous one solution cell proliferation assay
- ChEMBL_638841 (CHEMBL1166965) Inhibition of histidine-tagged human recombinant SRC expressed in baculovirus system assessed as [gamma32P]ATP utilization after 10 mins by liquid scintillation counting using ATP as substrate
- ChEMBL_638842 (CHEMBL1166966) Inhibition of histidine-tagged human recombinant SRC expressed in baculovirus system assessed as [gamma32P]ATP utilization after 10 mins by liquid scintillation counting using KVEKIGEGTYGVVYK as substrate
- ChEMBL_806398 (CHEMBL1959327) Inhibition of human GST-tagged c-SRC autophosphorylation using biotin-(6-amino caproic acid)-AAAQQIYGQ-NH2 as substrate after 40 mins by homogenous time-resolved fluorescence method
- ChEMBL_1815522 (CHEMBL4315096) Inhibition of wildtype FLT3 (unknown origin) using TAMRA-Src-tide as substrate measured after 1 hr in presence of ATP at its Km concentration by IMAP-FP assay
- ChEMBL_1815524 (CHEMBL4315098) Inhibition of FLT3 D835Y (unknown origin) using TAMRA-Src-tide as substrate measured after 1 hr in presence of ATP at its Km concentration by IMAP-FP assay
- ChEMBL_1856976 (CHEMBL4357705) Inhibition of recombinant human His-tagged full length SRC expressed in baculovirus expression system using tyrosine-2 peptide as substrate incubated for 1 hr by Z'-LYTE assay
- ChEMBL_2581751 Inhibition of Src in bortezomib Resistant human RPMI-8226 cells assessed as reduction of cell growth incubated for 72 hrs by CellTiter 96 aqueous one solution cell proliferation assay
- ChEMBL_2581845 Inhibition of Src in Melphalan Resistant human RPMI-8226 cells assessed as reduction of cell growth incubated for 72 hrs by CellTiter 96 aqueous one solution cell proliferation assay
- ChEMBL_2581975 Inhibition of Src family in human bortezomib-resistant ANBL6 cells assessed as reduction of cell growth incubated for 72 hrs by CellTiter 96 aqueous one solution cell proliferation assay
- FXR Ligand-Seeking Assay The assay measures ligand-mediated interaction of the SRC-1 peptide with the FXR ligand binding domain, using biotinylated FXR LBD coupled to allophycocyanin-labeled streptavidin and biotinylated SRC-1 coupled to Europium-labeled streptavidin. The EC50 values are the mean of at least two assays. Maximum percent efficacy of the test compound is relative to FXR activation via GW 4064.
- In Vitro Src Kinase Inhibition Test This assay determines the ability of test compounds to inhibit Src kinase activity that catalyzes the transfer of the terminal phosphate to the immobilized poly (Glu,Tyr) substrate detected using anti-phosphotyrosine monoclonal antibody conjugated to alkaline phosphatase. IC50 values for compound enzyme inhibition were obtained using KC3 Kineticalc software (Bio-Tek Instruments) following subtraction of the blank values.
- ChEBML_1691364 Inhibition of recombinant GST-tagged c-Src (unknown origin) expressed in insect cells using pEY as substrate preincubated with enzyme followed by [33P]ATP addition measured after after 120 mins
- ChEMBL_1515327 (CHEMBL3615120) Inhibition of His6-tagged Src kinase domain (unknown origin) using AEEEIYGEFEAKKKK as substrate preincubated for 10 mins followed by substrate/ATP addition measured after 30 mins by fluorescence assay
- ChEMBL_1815523 (CHEMBL4315097) Inhibition of FLT3 ITD mutant (unknown origin) using TAMRA-Src-tide as substrate measured after 1 hr in presence of ATP at its Km concentration by IMAP-FP assay
- ChEMBL_1989430 (CHEMBL4623165) Inhibition of SRC (unknown origin) using FAM-labeled peptide and ATP as substrate preincubated for 10 mins followed by substrate addition measured after 1 hr by mobility shift assay
- ChEMBL_2155037 (CHEMBL5039697) Inhibition of human c-SRC using poly [Glu:Tyr] as substrate incubated for 30 mins followed by 33P-ATP addition and measured after 2 hrs by liquid scintillation counter method
- ChEMBL_2510980 Inhibition of c-SRC (249 to 536 residues) (unknown origin) using pEY (4:1) and bio-pEY as substrate for 30 min in the presence of ATP by ELISA method
- ChEMBL_2578590 Inhibition of GST tagged Src (unknown origin) assessed as inhibition of phosphorylation using PTK biotinylated peptide substrate 2 as substrate preincubated for 5 mins followed by [gamma-32P]ATP addition
- ChEMBL_2581694 Inhibition of Src family in bortezomib Resistant human RPMI-8226 cells assessed as reduction of cell growth incubated for 72 hrs by CellTiter 96 aqueous one solution cell proliferation assay
- ChEMBL_2581788 Inhibition of Src family in Melphalan Resistant human RPMI-8226 cells assessed as reduction of cell growth incubated for 72 hrs by CellTiter 96 aqueous one solution cell proliferation assay
- ChEMBL_726327 (CHEMBL1687315) Inhibition of STAT3 dimerization in mouse NIH3T3 cells expressing v-Src assessed as disruption of STAT3-STAT3: DNA complexation in nucleus after 30 mins by electrophoretic mobility shift assay
- ChEMBL_795748 (CHEMBL1936377) Inhibition of His6-tagged c-Src kinase domain using AEEEIYGEFEAKKKK as substrate pre-incubated for 10 mins before substrate addition measured after 30 mins by Transcreener ADP2 FI Assay
- ChEMBL_863007 (CHEMBL2175187) Inhibition of STAT3 dimerization in v-Src transformed mouse NIH/3T3 cells overexpressing human EGFR assessed as suppression of STAT3-DNA interaction in nucleus after 30 mins by EMSA
- ChEMBL_1618939 (CHEMBL3861108) Inhibition of Src in mouse BV2 cells assessed as suppression of LPS-induced NO release preincubated for 1 hr followed by LPS addition measured after 24 hrs by Griess assay
- ChEMBL_1807495 (CHEMBL4306854) Inverse agonist activity at human biotinylated HN-Avi-MBPS-TCS-RORC2 (258 to 518 residues) assessed as recruitment of SRC-1-derived coactivator measured after 15 mins by FRET assay
- ChEMBL_1823041 (CHEMBL4322805) Binding affinity to recombinant full-length N-terminal His-FLAG-GST-tagged SRC (unknown origin) expressed in baculovirus infected Sf9 insect cells incubated for 1 hr by TR-FRET assay
- ChEMBL_1831117 (CHEMBL4331125) Inhibition of human c-SRC using poly[Glu:Tyr] (4:1) as substrate preincubated for 20 mins followed by [gamma-33P]-ATP addition and measured after 120 mins by Hotspot assay
- ChEMBL_2159319 (CHEMBL5044069) Inhibition of human APC-labeled RORgammat LBD (262 to 518 residues) transfected in Escherichia coli BL21 (DE3) assessed as biotinylated SRC recruitment incubated for 1 hr by dual FRET assay
- ChEBML_1970807 Inhibition of recombinant full length human His-tagged SRC expressed in baculovirus expression system using tyrosine-2 peptide as substrate incubated for 60 mins in presence of ATP by Z'-LYTE assay
- ChEMBL_1754216 (CHEMBL4188976) Inhibition of wild-type human partial length SRC (L240 to L536 residues) expressed in bacterial expression system using poly [Glu, Try] 4:1 as substrate in presence of [gamma-33P]ATP
- ChEMBL_1644759 (CHEMBL3993688) Inhibition of human recombinant full length N-terminal His6-tagged Src expressed in Sf21 cells using KVEKIGEGTYGVVYK as substrate after 10 mins in presence of [gamma-33P]ATP by scintillation counting method
- ChEMBL_2057493 (CHEMBL4712494) Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT3 SH2 domain in mouse NIH3T3/v-Src nuclear extract preincubated for 30 mins followed by hSIE probe addition by EMSA analysis
- ChEMBL_2583126 Inhibition of human c-Src using poly[Glu:Tyr] (4:1) as substrate preincubated for 20 mins followed by [gamma-33P]-ATP addition and measured after 120 mins by radiometric Hot-SpotSM Kinase assay
- AlphaScreen Assay AlphaScreen was used with the aim of identifying novel modulators by taking advantage of the bimolecular interaction prevailing between FXR and the LXXLL motif present in the NR box of the steroid receptor coactivator 1 (SRC-1).Human FXR-LBD-GST was incubated with increasing concentrations of the indicated ligands in the presence of biotinylated LXXLL SRC-1 peptide. The AlphaScreen signal increases when the complex receptor-coactivator is formed.
- ChEMBL_1587510 (CHEMBL3825319) Inhibition of 6x-His-tagged human Src kinase domain (T250 to L536 residues) expressed in Sf9 cells incubated for 2 hrs in presence of biotinylated cdc2 peptide substrate by homogenous TR-FRET assay
- ChEMBL_1671203 (CHEMBL4021232) Inhibition of c-Src (unknown origin) using FAM-labeled peptide as substrate preincubated for 5 to 10 mins followed by substrate/ATP addition measured after 30 to 60 mins by mobility shift assay
- ChEMBL_1864113 (CHEMBL4365088) Inhibition of human recombinant full length N-terminal GST tagged SRC expressed in Escherichia coli using KVEKIGEGTYGVVYK-amide as substrate measured after 60 mins in presence of ATP by ADP-Glo kinase assay
- ChEMBL_2323061 Inverse agonist activity at His6-tagged human RORgammat LBD expressed in Escherichia coli BL21(DE3) assessed as decrease in SRC-1 recruitment using Biotin-SPSSHSSLTERHKILHRLLQEGSP as substrate incubated for 15 mins by TRET assay
- ChEMBL_2460198 Inhibition of SRC (unknown origin) using FAM-P22 peptide as substrate preincubated with compound for 10 mins followed by substrate addition and ATP measured after 60 mins by fluorescence-based microfluidic mobility shift assay
- ChEMBL_2527527 Inhibition of c-Src (unknown origin) expressed in Bac-to-Bac baculovirus expression system using poly(Glu-Tyr) at 4:1 ratio as substrate in presence of ATP incubated for 60 mins by ELISA
- ChEBML_1680860 Inhibition of human Src kinase domain (254 to 536 residues) expressed in Escherichia coli BL21 (DE3) using abltide as substrate pre-incubated for 10 mins followed by ATP addition measured after 20 mins by ELISA
- ChEMBL_2543817 Inhibition of human wild type full length SRC (1 to 536 residues) using PolyEY as substrate preincubated for 2 hrs followed by ATP addition and measured every 2 mins for 2.5 hrs by spectrophotometric analysis
- ChEMBL_772464 (CHEMBL1839255) Agonist activity at human amino-terminal polyhistidine-tagged FXR alpha LBD (amino acids 237 to 472) assessed as cofactor peptide SRC-1 interaction with receptor ligand binding domain after 2 hrs by FRET assay
- Kinase Inhibition Assay Src kinase activity was measured in an ELISA format. IC50 is the inhibitor concentration which inhibits 50% of kinase activity that catalyzes the transfer of the terminal phosphate from ATP to the substrate.
- Kinase inhibition Assay Src kinase activity was measured in an ELISA format. IC50 is the inhibitor concentration which inhibits 50% of kinase activity that catalyzes the transfer of the terminal phosphate from ATP to the substrate.
- ChEBML_1682383 Agonist activity at recombinant human GST-tagged FXR ligand binding domain (193 to 472 residues) expressed in baculovirus infected insect cells assessed as induction of interaction with biotin labelled SRC-1 after 1 hr by HTRF assay
- ChEMBL_1706900 (CHEMBL4058133) Inhibition of recombinant human full length N-terminal His6-tagged SRC expressed in Sf21 insect cells preincubated for 5 mins followed by substrate addition after 30 to 60 mins in presence of ATP by fluorescence assay
- TR-FRET Assay Compounds were screened in the TR-FRET assay for JAK2 and c-Src kinase inhibition. Ultra light poly GT (Perkin Elmer) was used as the substrate for JAK2 and c-Src with the ATP concentration of 10 μM and 50 μM, respectively. The Eu-labelled anti-phospho tyrosine antibody (Perkin Elmer) was added at 1 nM and the fluorescence emission at 615 nm and 665 nm was measured with an excitation wavelength of 340 nm.
- ChEMBL_1682383 (CHEMBL4032660) Agonist activity at recombinant human GST-tagged FXR ligand binding domain (193 to 472 residues) expressed in baculovirus infected insect cells assessed as induction of interaction with biotin labelled SRC-1 after 1 hr by HTRF assay
- ChEMBL_2448330 Inhibition of N-terminal GST-tagged recombinant full length human c-Src kinase expressed in baculovirus-infected Sf9 cells preincubated for 30 mins followed by HTRF buffer addition and measured after 1 hr by HTRF KinEASE-TK assay
- Tyrosine Kinase Assay Src, Lck, Flt-1, ZAP, EGFR, FGFR1, and PFGFR-beta were assayed in the Merck research laboratory (Homogeneous proximity tyrosine kinase assays: scintillation proximity assay versus homogeneous time-resolved fluorescence. Anal. Biochem. 1999, 269, 94-104.)
- ChEMBL_2145686 (CHEMBL5029966) Inhibition of human recombinant His-tagged c-Src protein (86 to 536 residues) autophosphorylation at Y419 residue expressed in Escherichia coli BL21 (DE3) preincubated for 1 hr followed by ATP addition and measured after 30 mins by ALPHA assay
- Fluorescence Polarization Assay For the fluorescence polarization experiments, 5 nM fluorescently labeled Bag-1L (Bag-1L(1-20), fluorescein isothiocyanate (FITC)-MAQRGGARRPRGDRERLGSR; Bag-1L(61-80), FITC-RGAAAGARRPRMKKKTRRRS) or SRC-2 peptide (FITC-HDSKGQTKLLQLLTTKSDQM) was incubated with serially diluted AR-LBD (4 to 0.4 μM) in binding buffer (50 mM NaPO4, pH 6.5, 50 mM KCl, 1 mM DTT) and 10 μM DHT. The samples were then equilibrated for 45 min at ambient temperature. For the competition experiments, 400 to 0.4 nM Bag-1L core (GARRPR) or SRC-2 peptides (HDSKGQTKLLQLLTTKSDQM) were incubated with 4 μM AR-LBD and 5 nM fluorescent Bag-1 or SRC-2 peptide. Binding was measured using polarization (excitation λ = 485 nm, emission λ = 530 nm) on a Synergy H1 hybrid reader (Biotek).
- c-Src Enzyme Inhibition 1 The inhibitory activities of compounds of the invention against c-Src and Syk enzymes (Invitrogen), are evaluated in a similar fashion to that described hereinabove. The c-Src enzyme (3000 ng/mL, 2.5 μL) is incubated with the test compound (either 4 μg/mL, 0.4 μg/mL, 0.04 μg/mL, or 0.004 μg/mL, 2.5 μL each) for 2 hr at RT. The FRET peptides (8 μM, 2.5 μL), and appropriate ATP solutions (2.5 μL, 800 μM) are then added to the enzymes/compound mixtures and incubated for 1 hr. Development reagent (protease, 5 μL) is added for 1 hr prior to detection in a fluorescence microplate reader (Varioskan Flash, ThermoFisher Scientific).
- c-Src Enzyme Inhibition 2 The inhibitory activities of compounds of the invention against c-Src and Syk enzymes (Invitrogen), are evaluated in a similar fashion to that described hereinabove. The c-Src enzyme (3000 ng/mL, 2.5 μL) is incubated with the test compound (either 4 μg/mL, 0.4 μg/mL, 0.04 μg/mL, or 0.004 μg/mL, 2.5 μL each) for 2 hr at RT. The FRET peptides (8 μM, 2.5 μL), and appropriate ATP solutions (2.5 μL, 800 μM) are then added to the enzymes/compound mixtures and incubated for 1 hr. Development reagent (protease, 5 μL) is added for 1 hr prior to detection in a fluorescence microplate reader (Varioskan Flash, ThermoFisher Scientific).
- c-Src and Syk Enzyme Inhibition Assay The inhibitory activities of compounds of the invention against c-Src and Syk enzymes (Invitrogen), are evaluated in a similar fashion to that described hereinabove. The relevant enzyme (3000 ng/mL or 2000 ng/mL respectively, 2.5 uL) is incubated with the test compound (either 4 ug/mL, 0.4 ug/mL, 0.04 ug/mL, or 0.004 ug/mL, 2.5 uL each) for 2 hr at RT. The FRET peptides (8 uM, 2.5 uL), and appropriate ATP solutions (2.5 uL, 800 uM for c-Src, and 60 uM ATP for Syk) are then added to the enzymes/compound mixtures and incubated for 1 hr. Development reagent (protease, 5 uL) is added for 1 hr prior to detection in a fluorescence microplate reader (Varioskan Flash, ThermoFisher Scientific).
- ChEMBL_1587941 (CHEMBL3824531) Inhibition of C-terminal His-tagged full length human SRC expressed in insect cells preincubated for 20 mins using poly[Glu,Tyr]4:1 as substrate measured after 5 to 120 mins in presence of [gamma-33P]ATP by Kinome assay
- In Vitro Assay of Compounds of the Present Invention for Inhibiting Src Kinase Activity Assay After the compound serially diluted with DMSO and a Src recombinant protein were incubated at room temperature for 10 min, the reaction was initiated by the addition of a biotin-labeled TK substrate and ATP. After the mixture was left to stand at room temperature for 40 min Sa-XL 665 and a Cryptate-labeled antibody were added. The fluorescence values at 615 nm and 665 nm were measured, and the ratio of 665 nm to 615 nm was calculated.
- Luciferase-Based Assay Recombinant human c-Src or Yes (28 ng/well, Panvera/Invitrogen, Madison Wis.), ATP (3 μM), a tyrosine kinase substrate (PTK2, 250 μM, Promega Corp., Madison Wis.), and test agents (at concentrations ranging from about 1 nM/l to about 100 μM/l), in the presence of Src kinase reaction buffer (Upstate USA, Lake Placid N.Y.). After reacting for about 90 minutes at room temperature, residual ATP was determined using a luciferase-based assay (KinaseGlo, Promega Corp.) as a measure of kinase activity.
- Enzyme Inhibition c-Src and Syk: The inhibitory activities of compounds of the invention against c-Src and Syk enzymes (Invitrogen), are evaluated in a similar fashion to that described hereinabove. The relevant enzyme (3000 ng/mL or 2000 ng/mL respectively, 2.5 μL) is incubated with the test compound (either 4 μg/mL, 0.4 μg/mL, 0.04 μg/mL, or 0.004 μg/mL, 2.5 μL each) for 2 hr at RT. The FRET peptides (8 μM, 2.5 μL), and appropriate ATP solutions (2.5 μL, 800 μM for c-Src, and 60 μM ATP for Syk) are then added to the enzymes/compound mixtures and incubated for 1 hr. Development reagent (protease, 5 μL) is added for 1 hr prior to detection in a fluorescence microplate reader (Varioskan Flash, ThermoFisher Scientific).
- Enzyme Inhibition c-Src and Syk: The inhibitory activities of compounds of the invention against c-Src and Syk enzymes (Invitrogen), were evaluated in a similar fashion to that described hereinabove. The relevant enzyme (3000 ng/mL or 2000 ng/mL respectively, 2.5 μL) was incubated with the test compound (either 4 μg/mL, 0.4 μg/mL, 0.04 μg/mL, or 0.004 μg/mL, 2.5 μL each) for 2 hr at RT. The FRET peptides (8 μM, 2.5 μL), and appropriate ATP solutions (2.5 μL, 800 μM for c-Src, and 60 μM ATP for Syk) were then added to the enzyme/compound mixtures and incubated for 1 hr. Development reagent (protease, 5 μL) was added for 1 hr prior to detection in a fluorescence microplate reader (Varioskan Flash, ThermoFisher Scientific).
- c-Src and Syk Enzyme Inhibition The inhibitory activities of compounds of the invention against c-Src and Syk enzymes (Invitrogen), were evaluated in a similar fashion to that described hereinabove. The relevant enzyme (3000 ng/mL or 2000 ng/mL respectively, 2.5 μL) was incubated with the test compound (either 4 μg/mL, 0.4 μg/mL, 0.04 μg/mL, or 0.004 μg/mL, 2.5 μL each) for 2 hr at RT. The FRET peptides (8 μM, 2.5 μL), and appropriate ATP solutions (2.5 μL, 800 μM for c-Src, and 60 μM ATP for Syk) were then added to the enzyme/compound mixtures and incubated for 1 hr. Development reagent (protease, 5 μL) was added for 1 hr prior to detection in a fluorescence microplate reader (Varioskan Flash, ThermoFisher Scientific).
- ChEMBL_1840425 (CHEMBL4340724) Inhibition of recombinant human full-length N-terminal GST-His6-fused SRC (M1 to L536 residues) expressed in Sf9 insect cells using Poly(Glu:Tyr)4:1 as substrate measured after 60 mins in presence of [gamma-33P]-ATP by scintillation counting method
- ChEMBL_1883983 (CHEMBL4385482) Inhibition of full-length recombinant human C-terminal His-tagged SRC cytoplasmic domain expressed in baculovirus expression system using FAM-Srctide peptide as substrate preincubated for 1 hr followed by substrate addition and measured after 1 hr by TR-FRET Lanthascreen assay
- ChEMBL_2475467 Inhibition of C-terminal 6His-tagged recombinant human STAT3 (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 10 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
- ChEMBL_2475468 Inhibition of C-terminal 6His-tagged recombinant human STAT3 (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
- ChEMBL_2475469 Inhibition of C-terminal 6His-tagged recombinant human STAT3 (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 60 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
- Enzyme Inhibition Assay c-Src and Syk Enzyme InhibitionThe inhibitory activities of compounds of the invention against c-Src and Syk enzymes (Invitrogen), are evaluated in a similar fashion to that described hereinabove. The relevant enzyme (3000 ng/mL or 2000 ng/mL respectively, 2.5 μL) is incubated with the test compound (either 4 μg/mL, 0.4 μg/mL, 0.04 μg/mL, or 0.004 μg/mL, 2.5 μL each) for 2 hr at RT. The FRET peptides (8 μM, 2.5 μL), and appropriate ATP solutions (2.5 μL, 800 μM for c-Src, and 60 μM ATP for Syk) are then added to the enzymes/compound mixtures and incubated for 1 hr. Development reagent (protease, 5 μL) is added for 1 hr prior to detection in a fluorescence microplate reader (Varioskan Flash, ThermoFisher Scientific).
- Enzyme Inhibition c-Src and Syk: The inhibitory activities of compounds of the invention against c-Src and Syk enzymes (Invitrogen), are evaluated in a similar fashion to that described hereinabove. The relevant enzyme (3000 ng/mL or 2000 ng/mL respectively, 2.5 μL) is incubated with the test compound (either 1 μg/mL, 0.1 μg/mL, 0.01 μg/mL, or 0.001 μg/mL, 2.5 μL each) for 2 hr at RT. The FRET peptides (8 μM, 2.5 μL), and appropriate ATP solutions (2.5 μL, 800 μM for c-Src, and 60 μM ATP for Syk) are then added to the enzymes/compound mixtures and the mixture incubated for 1 hr. Development reagent (protease, 5 μL) is added for 1 hr prior to detection in a fluorescence microplate reader (Varioskan Flash, ThermoFisher Scientific).
- c-Src and Syk Enzyme Inhibition Assay The inhibitory activities of compounds of the invention against c-Src and Syk enzymes (Invitrogen), are evaluated in a similar fashion to that described hereinabove. The relevant enzyme (3000 ng/mL or 2000 ng/mL respectively, 2.5 μL) is incubated with the test compound (either 1 μg/mL, 0.1 μg/mL, 0.01 μg/mL, or 0.001 μg/mL, 2.5 μL each) for 2 hr at RT. The FRET peptides (8 μM. 2.5 μL), and appropriate ATP solutions (2.5 μL, 800 μM for c-Src, and 60 μM ATP for Syk) are then added to the enzymes/compound mixtures and the mixture incubated for 1 hr. Development reagent (protease, 5 μL) is added for 1 hr prior to detection in a fluorescence microplate reader (Varioskan Flash, ThermoFisher Scientific).
- c-Src and Syk Enzyme Inhibition Assay The inhibitory activities of compounds of the invention against c-Src and Syk enzymes (Invitrogen), are evaluated in a similar fashion to that described hereinabove. The relevant enzyme (3000 ng/mL or 2000 ng/mL respectively, 2.5 μL) is incubated with the test compound (either 4 μg/mL, 0.4 μg/mL, 0.04 μg/mL, or 0.004 μg/mL, 2.5 μL each) for 2 hr at RT. The FRET peptides (8 μM. 2.5 μL), and appropriate ATP solutions (2.5 μL, 800 μM for c-Src, and 60 μM ATP for Syk) are then added to the enzymes/compound mixtures and incubated for 1 hr. Development reagent (protease, 5 μL) is added for 1 hr prior to detection in a fluorescence microplate reader (Varioskan Flash, ThermoFisher Scientific).
- c-Src and Syk Enzyme Inhibition The inhibitory activities of compounds of the invention against c-Src and Syk enzymes (Invitrogen), are evaluated in a similar fashion to that described hereinabove. The relevant enzyme (3000 ng/mL or 2000 ng/mL respectively, 2.5 μL) is incubated with the test compound (either 1 μg/mL, 0.1 μg/mL, 0.01 μg/mL, or 0.001 μg/mL, 2.5 μL each) for 2 hr at RT. The FRET peptides (8 μM. 2.5 μL), and appropriate ATP solutions (2.5 μL, 800 μM for c-Src, and 60 μM ATP for Syk) are then added to the enzymes/compound mixtures and the mixture incubated for 1 hr. Development reagent (protease, 5 μL) is added for 1 hr prior to detection in a fluorescence microplate reader (Varioskan Flash, ThermoFisher Scientific).
- ChEMBL_1587984 (CHEMBL3824738) Competitive inhibition of C-terminal His-tagged full length human SRC expressed in insect cells preincubated for 20 mins using poly[Glu,Tyr]4:1 as substrate measured after 5 to 120 mins by Michaelis-Menten plot and by Lineweaver-Burk plot analysis analysis
- ChEMBL_2059672 (CHEMBL4714673) Orthosteric agonist activity at recombinant human N-terminal His6-tagged RORgammat ligand binding domain (265 to 518 residues) expressed in Escherichia coli BL21 (DE3) assessed as increase in coactivator, N-terminal biotinylated SRC-1 box2 peptide recruitment incubated for 60 mins by TR-FRET assay
- ChEMBL_2145685 (CHEMBL5029965) Inhibition of human recombinant flag-tagged c-Src protein (86 to 536 residues) catalytic activity expressed in Escherichia coli BL21 (DE3) cells using biotinylated TK-substrate peptide as substrate preincubated for 1 hr followed by substrate addition and measured after 1 hr by HTRF assay
- Scintillation Proximity Assay (SPA) SPA uses 125I as energy donor and scintillant-coated beads as energy acceptor. The labeled ligand is captured by the biotinylated Src-SH2 protein immobilized on streptavidin beads, resulting in the emission of light. IC50 values were obtained from competitive binding assay.
- SRC Inhibitory Activity Measurement Regarding the conditions for measurement of in vitro inhibitory activity of compounds against SRC kinase activity, the price list of LabChip-series consumable reagents of PerkinElmer shows that FL-Peptide 4 corresponds to the substrate peptide for reaction to measure SRC kinase activity. Thus, FL-Peptide 4 was used as a substrate. The purified recombinant human SRC protein used in the test was purchased from Carna Biosciences, Inc.To measure the inhibitory activity, first, the compounds of the present invention were individually diluted with dimethyl sulfoxide (DMSO) stepwise. Subsequently, SRC protein, FL-Peptide 4 (final concentration: 1.5 μM), magnesium chloride (final concentration: 10 mM), ATP (final concentration: 15 μM), and a solution of the compound of the present invention in DMSO (final concentration of DMSO: 5%) were added to a reaction buffer (100 mM HEPES, pH of 7.0, 1 mM dithiothreitol, 0.003% Brij35, 0.04% Tween-20) containing a phosphatase inhibitor cocktail (PhosSTOP, Roche) and a protease inhibitor cocktail (complete Mini, EDTA-free, Roche) at recommended concentrations. Each mixture was incubated at 30° C. for 90 minutes to perform kinase reaction. EDTA diluted with a separation buffer available from PerkinElmer (final concentration: 30 mM) was then added thereto to terminate the kinase reaction. Finally, non-phosphorylated substrate peptides (S) and phosphorylated peptides (P) were separated and detected by microchannel capillary electrophoresis using LabChip EZ Reader II (PerkinElmer). The phosphorylation level was calculated from the height of the peaks of S and P, and the compound concentration at which phosphorylation was inhibited by 50% was defined as IC50 value (nM).
- ChEMBL_2059671 (CHEMBL4714672) Orthosteric inverse agonist activity at recombinant human N-terminal His6-tagged RORgammat ligand binding domain (265 to 518 residues) expressed in Escherichia coli BL21 (DE3) assessed as reduction in coactivator, N-terminal biotinylated SRC-1 box2 peptide recruitment incubated for 60 mins by TR-FRET assay
- ChEMBL_2475470 Inhibition of recombinant wild type tyrosine phosphorylated C-terminal 6His tagged human STAT3 (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
- Inhibition Assay The assay is a capture of radioactive 33P phosphorylated product through filtration. The interactions of Btk, biotinylated SH2 peptide substrate (Src homology), and ATP lead to phosphorylation of the peptide substrate. Biotinylated product is bound streptavidin sepharose beads. All bound, radiolabeled products are detected by scintillation counter.