Found 583 with Last Name = 'messore' and Initial = 'a' 
Affinity DataKi: 182nMAssay Description:Inhibition of equine BChE assessed as inhibition constant using acetylthiocholine as substrate measured for 0.5 to 1.5 mins by Ellman's methodMore data for this Ligand-Target Pair
Affinity DataKi: 258nMAssay Description:Inhibition of equine BChE assessed as inhibition constant using acetylthiocholine as substrate measured for 0.5 to 1.5 mins by Ellman's methodMore data for this Ligand-Target Pair
TargetDNA nucleotidylexotransferase(Homo sapiens (Human))
Sapienza University Of Rome
Curated by ChEMBL
Sapienza University Of Rome
Curated by ChEMBL
Affinity DataKi: 400nMAssay Description:Non-competitive inhibition of human TdT using 3'-OH as substrateMore data for this Ligand-Target Pair
TargetDNA nucleotidylexotransferase(Homo sapiens (Human))
Sapienza University Of Rome
Curated by ChEMBL
Sapienza University Of Rome
Curated by ChEMBL
Affinity DataKi: 450nMAssay Description:Competitive inhibition of human TdT using TTP as substrateMore data for this Ligand-Target Pair
Affinity DataKi: 450nMAssay Description:Inhibition of equine BChE assessed as inhibition constant using acetylthiocholine as substrate measured for 0.5 to 1.5 mins by Ellman's methodMore data for this Ligand-Target Pair
TargetDNA nucleotidylexotransferase(Homo sapiens (Human))
Sapienza University Of Rome
Curated by ChEMBL
Sapienza University Of Rome
Curated by ChEMBL
Affinity DataKi: 500nMAssay Description:Non-competitive inhibition of human TdT using 3'-OH as substrateMore data for this Ligand-Target Pair
TargetDNA nucleotidylexotransferase(Homo sapiens (Human))
Sapienza University Of Rome
Curated by ChEMBL
Sapienza University Of Rome
Curated by ChEMBL
Affinity DataKi: 500nMAssay Description:Competitive inhibition of human TdT using TTP as substrateMore data for this Ligand-Target Pair
TargetAcetylcholinesterase(Electrophorus electricus (Electric eel))
Sapienza University Of Rome
Curated by ChEMBL
Sapienza University Of Rome
Curated by ChEMBL
Affinity DataKi: 788nMAssay Description:Inhibition of electric eel AChE assessed as inhibition constant using acetylthiocholine as substrate measured for 0.5 to 1.5 mins by Ellman's methodMore data for this Ligand-Target Pair
Affinity DataKi: 910nMAssay Description:Inhibition of equine BChE assessed as inhibition constant using acetylthiocholine as substrate measured for 0.5 to 1.5 mins by Ellman's methodMore data for this Ligand-Target Pair
Affinity DataKi: 920nMAssay Description:Inhibition of equine BChE assessed as inhibition constant using acetylthiocholine as substrate measured for 0.5 to 1.5 mins by Ellman's methodMore data for this Ligand-Target Pair
Affinity DataKi: 1.08E+3nMAssay Description:Inhibition of equine BChE assessed as inhibition constant using acetylthiocholine as substrate measured for 0.5 to 1.5 mins by Ellman's methodMore data for this Ligand-Target Pair
TargetAcetylcholinesterase(Electrophorus electricus (Electric eel))
Sapienza University Of Rome
Curated by ChEMBL
Sapienza University Of Rome
Curated by ChEMBL
Affinity DataKi: 1.34E+3nMAssay Description:Inhibition of electric eel AChE assessed as inhibition constant using acetylthiocholine as substrate measured for 0.5 to 1.5 mins by Ellman's methodMore data for this Ligand-Target Pair
TargetAcetylcholinesterase(Electrophorus electricus (Electric eel))
Sapienza University Of Rome
Curated by ChEMBL
Sapienza University Of Rome
Curated by ChEMBL
Affinity DataKi: 1.37E+3nMAssay Description:Inhibition of electric eel AChE assessed as inhibition constant using acetylthiocholine as substrate measured for 0.5 to 1.5 mins by Ellman's methodMore data for this Ligand-Target Pair
TargetDNA nucleotidylexotransferase(Homo sapiens (Human))
Sapienza University Of Rome
Curated by ChEMBL
Sapienza University Of Rome
Curated by ChEMBL
Affinity DataKi: 1.50E+3nMAssay Description:Competitive inhibition of human TdT using TTP as substrateMore data for this Ligand-Target Pair
TargetDNA nucleotidylexotransferase(Homo sapiens (Human))
Sapienza University Of Rome
Curated by ChEMBL
Sapienza University Of Rome
Curated by ChEMBL
Affinity DataKi: 1.70E+3nMAssay Description:Non-competitive inhibition of human TdT using 3'-OH as substrateMore data for this Ligand-Target Pair
Affinity DataKi: 2.36E+3nMAssay Description:Inhibition of equine BChE assessed as inhibition constant using acetylthiocholine as substrate measured for 0.5 to 1.5 mins by Ellman's methodMore data for this Ligand-Target Pair
TargetAcetylcholinesterase(Electrophorus electricus (Electric eel))
Sapienza University Of Rome
Curated by ChEMBL
Sapienza University Of Rome
Curated by ChEMBL
Affinity DataKi: 2.79E+3nMAssay Description:Inhibition of electric eel AChE assessed as inhibition constant using acetylthiocholine as substrate measured for 0.5 to 1.5 mins by Ellman's methodMore data for this Ligand-Target Pair
Affinity DataIC50: 5nMAssay Description:Inhibition of recombinant HPSE (unknown origin) using fondaparinux as substrate incubated for 3 hrs in absence of light by WST1 assayMore data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 10nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 10nMAssay Description:Inhibition of human CYP2D6 in presence of NADPH by luciferase reporter gene assayMore data for this Ligand-Target Pair
3D Structure (crystal)Affinity DataIC50: 10nMAssay Description:Inhibition of human CYP2D6 in presence of NADPH by luciferase reporter gene assayMore data for this Ligand-Target Pair
Affinity DataIC50: 12nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 15nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 16nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 18nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 19nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: 19nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 19nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 22nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 24nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 26nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 28nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 28nMAssay Description:Inhibition of HIV1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 33nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 34nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£
Curated by ChEMBL
"Sapienza" Universit£
Curated by ChEMBL
Affinity DataIC50: 35nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Affinity DataIC50: 38nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 42nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 43nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 46nMAssay Description:Binding affinity to His6-tagged recombinant HIV1 Integrase assessed as inhibition of protein interaction with 3xFLAG-tagged LEDGF/p75 preincubated fo...More data for this Ligand-Target Pair
Affinity DataIC50: 50nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 50nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: 50nMAssay Description:Inhibition of HIV1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 52nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 57nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 59nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 63nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 66nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
