Found 416 with Last Name = 'madia' and Initial = 'vn' 
Affinity DataIC50: 5nMAssay Description:Inhibition of recombinant HPSE (unknown origin) using fondaparinux as substrate incubated for 3 hrs in absence of light by WST1 assayMore data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 10nMAssay Description:Inhibition of human CYP2D6 in presence of NADPH by luciferase reporter gene assayMore data for this Ligand-Target Pair
3D Structure (crystal)
Affinity DataIC50: 10nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 10nMAssay Description:Inhibition of human CYP2D6 in presence of NADPH by luciferase reporter gene assayMore data for this Ligand-Target Pair
Affinity DataIC50: 12nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 15nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 16nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 18nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 19nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: 19nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 19nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 22nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 24nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 28nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 28nMAssay Description:Inhibition of HIV1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 33nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 34nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£
Curated by ChEMBL
"Sapienza" Universit£
Curated by ChEMBL
Affinity DataIC50: 35nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Affinity DataIC50: 38nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 43nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 46nMAssay Description:Binding affinity to His6-tagged recombinant HIV1 Integrase assessed as inhibition of protein interaction with 3xFLAG-tagged LEDGF/p75 preincubated fo...More data for this Ligand-Target Pair
Affinity DataIC50: 50nMAssay Description:Inhibition of HIV1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 50nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: 50nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 57nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 63nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 66nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 80nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 80nMAssay Description:Inhibition of recombinant HPSE (unknown origin) using fondaparinux as substrate incubated for 3 hrs in absence of light by WST1 assayMore data for this Ligand-Target Pair
Affinity DataIC50: 80nMAssay Description:Inhibition of HIV-1 HXB2 integrase using 32P-labelled oligonucleotide as substrate after 1 hr by phosphorimager analysisMore data for this Ligand-Target Pair
Affinity DataIC50: 80nMAssay Description:Inhibition of HIV1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 80nMAssay Description:Inhibition of HIV1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 87nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 87nMAssay Description:Inhibition of HIV1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 96nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 100nMAssay Description:Inhibition of HIV1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 110nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 110nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 130nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 140nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
Affinity DataIC50: 150nMAssay Description:Inhibition of HIV1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 160nMAssay Description:Inhibition of recombinant HPSE GS3 (unknown origin) using fondaparinux as substrate incubated for 3 hrs in absence of light by WST1 based colorimetryMore data for this Ligand-Target Pair
Affinity DataIC50: 170nMAssay Description:Inhibition of HIV1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 180nMAssay Description:Inhibition of recombinant HPSE (unknown origin) using fondaparinux as substrate incubated for 3 hrs in absence of light by WST1 assayMore data for this Ligand-Target Pair
Affinity DataIC50: 190nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£
Curated by ChEMBL
"Sapienza" Universit£
Curated by ChEMBL
Affinity DataIC50: 190nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Affinity DataIC50: 200nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of 3'-processing activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in pr...More data for this Ligand-Target Pair
Affinity DataIC50: 210nMAssay Description:Inhibition of HIV1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 220nMAssay Description:Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in ...More data for this Ligand-Target Pair
