Simple Search Results

ChEMBL_2346015 Inhibition of HDAC in human HeLa nuclear extract
ChEMBL_2346044 Inhibition of HDAC1 in human HeLa nuclear extract
ChEMBL_2346045 Inhibition of HDAC2 in human HeLa nuclear extract
ChEMBL_472921 (CHEMBL921164) Inhibition of HDAC1 in rat liver extract
ChEBML_28421 Inhibition of AICAR formyltransferase from extract of Manca human lymphoma cells
ChEMBL_1552208 (CHEMBL3761210) Inhibition of HDAC in human HeLa nuclear extract
ChEMBL_1875110 (CHEMBL4376399) Inhibition of HDAC in human K562 nuclear extract
ChEMBL_1919932 (CHEMBL4422777) Inhibition of HDAC in human HeLa nuclear extract
ChEMBL_2439282 Inhibition of HDAC in human HeLa cells nuclear extract
ChEMBL_69929 (CHEMBL678809) Inhibition of GAR formyltransferase from extract of Manca human lymphoma cells
ChEMBL_1919890 (CHEMBL4422735) Inhibition of HDAC1/HDAC2 in human HeLa nuclear extract
ChEMBL_852177 (CHEMBL2157598) Inhibition of aCDase expressed in human HL60 cell extract
ChEMBL_432005 (CHEMBL918789) Inhibition of telomerase in JR8 cell extract by TRAP assay
ChEMBL_472923 (CHEMBL921166) Inhibition of HDAC1 in rat liver extract by trypsin assay
ChEMBL_873193 (CHEMBL2183424) Inhibition of DNA-PK isolated from human HeLa cell extract
ChEBML_54534 Inhibition of DNA-dependent protein kinase (DNA-PK) of HeLa cell nuclear cell extract
ChEMBL_209485 (CHEMBL810077) Inhibition of pure human thymidylate synthase from extract of Manca human lymphoma cells
ChEMBL_87718 (CHEMBL697246) Inhibition of histone deacetylase (HDAC) activity in HeLa cell nuclear extract
ChEMBL_28279 (CHEMBL645820) Inhibition of AGT activity to 50% of control rate in HT-29 cell extract
ChEMBL_756042 (CHEMBL1804152) Inhibition of NFkappa p65 isolated from nuclear extract of human HeLa cells by ELISA
ChEMBL_2105981 (CHEMBL4814656) Inhibition of telomerase in human SGC-7901 cell extract by TRAP assay
ChEMBL_2201302 (CHEMBL5114010) Inhibition of telomerase derived from human A2780 cell extract by TRAP assay
ChEMBL_2275541 Inhibition of human HDAC in human HeLa cell nuclear extract by fluorescence assay
ChEMBL_457624 (CHEMBL923825) Inhibition of HDAC activity in HeLa cell nuclear extract by fluorescent assay
ChEMBL_583224 (CHEMBL1055023) Inhibition of ALR2 from Sprague-Dawley albino rat lens extract by spectrophotometrically
ChEMBL_610879 (CHEMBL1065034) Inhibition of HDAC in human HeLa cell nuclear extract by fluorescence assay
ChEMBL_956022 (CHEMBL2380117) Inhibition of telomerase in human HL60 cell extract by TRAP-LIG assay
ChEMBL_34783 (CHEMBL646224) In vitro inhibition of Angiotensin I converting enzyme isolated from rabbit lung extract.
ChEMBL_653705 (CHEMBL1227029) Inhibition of HDAC in human HeLa cell extract by fluorescence plate reader assay
ChEMBL_1434455 (CHEMBL3388272) Inhibition of HDAC in human HeLa cell extract after 15 mins by fluorescence assay
ChEMBL_1580211 (CHEMBL3811519) Inhibition of HDAC1 in human Jurkat cells extract after 30 mins by immunoprecipitation assay
ChEMBL_1580212 (CHEMBL3811520) Inhibition of HDAC3 in human Jurkat cells extract after 30 mins by immunoprecipitation assay
ChEMBL_1990603 (CHEMBL4624338) Inhibition of NF-kappaB p65 in human HeLa cells nuclear extract by chemiluminescent assay
ChEMBL_557374 (CHEMBL955704) Inhibition of PSMA in human LNCaP cell extract using [3H]NAAG by radiometric assay
ChEMBL_2201829 (CHEMBL5114537) Inhibition of recombinant human Top1 derived from human MCF7 cell extract incubated for 30 mins
ChEMBL_2213599 (CHEMBL5126731) Inhibition of HDAC1 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate
ChEMBL_2213600 (CHEMBL5126732) Inhibition of HDAC2 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate
ChEMBL_2213601 (CHEMBL5126733) Inhibition of HDAC8 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate
ChEMBL_2272806 Inhibition of HDAC1 in human HeLa nuclear extract incubated for 30 mins by fluorescence based analysis
ChEMBL_2339423 Inhibition of HDAC in human HeLa nuclear extract measured after 30 mins by fluorescence based assay
ChEMBL_2488043 Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate
ChEMBL_422105 (CHEMBL907102) In vitro inhibition of histone deacetylase activity using HeLa cell nuclear extract as enzyme source
ChEMBL_557375 (CHEMBL955705) Inhibition of PSMA in human LNCaP cell extract using [3H]NAAG by fluorescence-based assay
ChEMBL_776071 (CHEMBL1912767) Inhibition of HDAC in human HeLa cell extract assessed as fluorophore release by fluorescence spectrophotometry
ChEMBL_1700237 (CHEMBL4051219) Inhibition of HDAC 10 in human HeLa nuclear extract measured after 60 mins by fluorometric analysis
ChEMBL_2201312 (CHEMBL5114020) Inhibition of telomerase derived from human K562 cell extract incubated for 30 mins by TRAP assay
ChEMBL_223549 (CHEMBL845855) concentration required to reduce AGT activity to 50% of control rate in HT-29 cell extract.
ChEMBL_2236190 (CHEMBL5150086) Inhibition of HDAC in human HeLa nuclear extract measured after 30 mins by fluorescence based assay
ChEMBL_2239302 (CHEMBL5153198) Inhibition of HDAC in human NALM-6 nuclear extract incubated for 48 hrs by fluorometric analysis
ChEMBL_2274123 Inhibition of human HDAC using human HeLa cell nuclear extract measured after 60 mins by fluorescence assay
ChEMBL_2373527 Inhibition of HDAC in human HeLa cells nuclear extract incubated for 30 mins by multiplate reader analysis
ChEMBL_2373528 Inhibition of HDAC1 in human HeLa cells nuclear extract incubated for 30 mins by multiplate reader analysis
ChEMBL_2460780 Inhibition of HDAC in human HeLa cells nuclear extract incubated for 30 mins by multiplate reader analysis
ChEMBL_2525403 Inhibition of human HeLa cell nuclear extract purified DNA-PK using p53 peptide as substrate by ELISA
ChEMBL_28280 (CHEMBL645821) concentration required to reduce AGT activity to 50% of control rate in HT-29 cell extract.
ChEMBL_614728 (CHEMBL1114231) Inhibition of human HDAC in human HeLa cell nuclear extract after 15 mins by colorimetric assay
ChEMBL_753553 (CHEMBL1799171) Inhibition of HDAC6 in human HeLa cell nuclear extract after 30 mins by fluorescence microplate reader
ChEMBL_832314 (CHEMBL2066852) Inhibition of DNMT1 in human HeLa cell nuclear extract assessed as methylated substrate level by ELISA
ChEMBL_966564 (CHEMBL2399492) Inhibition of HDAC isolated from human HeLa cell nuclear extract after 30 mins by fluorescence assay
ChEMBL_977181 (CHEMBL2416774) Inhibition of HDAC in human HeLa cell extract using Fluor deLys as substrate by fluorimetric assay
ChEMBL_1527400 (CHEMBL3636775) Inhibition of human HDAC in HeLa cell nuclear extract by fluorometric assay using Fluor de Lys substrate
ChEMBL_1728624 (CHEMBL4143902) Inhibition of HDAC in human HeLa nuclear extract using Fluor de Lys as substrate by fluorimetric method
ChEMBL_1839042 (CHEMBL4339257) Inhibition of HDAC (unknown origin) in human HeLa cell nuclear extract using Color de Lys as substrate
ChEMBL_2150392 (CHEMBL5034854) Inhibition of human HDAC using human HeLa cell nuclear extract measured after 60 mins by fluorescence assay
ChEMBL_2201002 (CHEMBL5113710) Inhibition of HDAC1 derived from human HeLa nuclear extract using COLOR DE LYS substrate by colorimetric assay
ChEMBL_2488159 Inhibition of human HDAC extracted from human HeLa cell nuclear extract incubated for 30 mins by fluorometric analysis
ChEMBL_1772528 (CHEMBL4224640) Inhibition of chymotrypsin-like activity of 20S proteasome in human PC3 cell extract using Suc-LLVYaminoluciferin as substrate after 2 hrs
ChEMBL_1772529 (CHEMBL4224641) Inhibition of chymotrypsin-like activity of 20S proteasome in human LNCAP cell extract using Suc-LLVYaminoluciferin as substrate after 2 hrs
ChEMBL_873187 (CHEMBL2183418) Inhibition of DNA-PK isolated from human HeLa cell extract assessed as inhibition of p53 peptide fragment phosphorylation after 10 mins
ChEMBL_629937 (CHEMBL1109181) Inhibition of NFkappa p50 isolated from nuclear extract of human HeLa cells assessed as blockade of binding to biotinylated consesus sequence by chemiluminescence assay
ChEMBL_629938 (CHEMBL1109182) Inhibition of NFkappa p65 isolated from nuclear extract of human HeLa cells assessed as blockade of binding to biotinylated consesus sequence by chemiluminescence assay
ChEMBL_749381 (CHEMBL1785171) Inhibition of NFkappa p65 in nuclear extract of human HeLa cells assessed as blockade of NFkappa p65 binding to biotinylated-consesus sequence by ELISA
ChEMBL_1825529 (CHEMBL4325293) Inhibition of PI3Kdelta in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
ChEMBL_1825530 (CHEMBL4325294) Inhibition of VPS34 in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
ChEMBL_1986966 (CHEMBL4620513) Inhibition of HDAC in human HeLa cell nuclear extract using fluor-de-lys as substrate by spectrofluorometric analysis
ChEMBL_2047319 (CHEMBL4702018) Inhibition of HDAC in human HeLa nuclear extract using fluoroscence-labeled acetylated peptide as substrate by fluorometric assay
ChEMBL_2206578 (CHEMBL5119286) Inhibition of HDAC in human HeLa nuclear extract incubated for 30 mins by fluorescence-based Glo-luminescence assay
ChEMBL_2488178 Inhibition of HDAC3 in human HeLa cell nuclear extract incubated for 30 mins by fluorescence based microplate reader analysis
ChEMBL_873195 (CHEMBL2183783) Inhibition of ATM isolated from human HeLa cell extract using glutathione S-transferase-p53N66 as substrate by ELISA
ChEMBL_714888 (CHEMBL1663834) Inhibition of NF-kappaB p65 isolated from nuclear extract of human HeLa cells assessed as blockade of binding to biotinylated consesus sequence by chemiluminescence assay
ChEMBL_2355383 Inhibition of HDAC in human HeLa cell nuclear extract using Kac fluorogenic peptide as substrate containing residues 379-382 of p53 by fluorescence assay
ChEMBL_306888 (CHEMBL828694) In vitro inhibitory concentration against histone deacetylase of DU-145 prostate cell nuclear extract as deacetylation of biotinylated [3H]-acetyl histone H4 peptide
ChEBML_1684531 Inhibition of AChE1 in Anopheles gambiae body extract using acetylthiocholine iodide as substrate measured over 60 secs by Ellman's method
ChEMBL_143356 (CHEMBL751280) Inhibitory activity evaluated from soluble cell extract of Neuronal nitric oxide synthase and partially purified by DEAE-sepharose chromatography
ChEMBL_2157455 (CHEMBL5042115) Inhibition of HDAC in human HeLa nuclear extract using fluorogenic substrate incubated for 30 mins by fluorescence based assay
ChEMBL_2274135 Inhibition of human HDAC1 using human HeLa cell nuclear extract at 1 uM measured after 60 mins by fluorescence assay
ChEMBL_2274136 Inhibition of human HDAC2 using human HeLa cell nuclear extract at 1 uM measured after 60 mins by fluorescence assay
ChEMBL_2274137 Inhibition of human HDAC3 using human HeLa cell nuclear extract at 1 uM measured after 60 mins by fluorescence assay
ChEMBL_87390 (CHEMBL691505) Tested for Histone deacetylase enzyme inhibition assay using Eimeria tenella extract
ChEMBL_2310516 Inhibition of recombinant Top1 in Leishmania donovani Ag83 whole cell extract assessed as relaxation of supercoiled pBluescript SK(+) DNA measured by agarose gel electrophoresis analysis
ChEMBL_1351241 (CHEMBL3271696) Inhibition of HDAC in human HeLa cell nuclear extract using acetylated lysine as substrate after 30 mins by spectrophotometric analysis
ChEMBL_143357 (CHEMBL751281) Inhibitory activity evaluated from soluble cell extract of human Neuronal nitric oxide synthase and partially purified by DEAE-sepharose chromatography
ChEMBL_143358 (CHEMBL751652) Inhibitory activity evaluated from soluble cell extract of human nNeuronal nitric oxide synthase and partially purified by DEAE-sepharose chromatography
ChEMBL_1589349 (CHEMBL3830593) Inhibition of full length BRPF1 in human HUT78 cell nuclear/chromatin extract after 45 mins by chemoproteomic competition binding assay
ChEMBL_164142 (CHEMBL771466) Compound concentration which displaces 50% of [125I]-labeled 2-5A probe bound to RNase L from mouse L cell extract
ChEMBL_1684530 (CHEMBL4035009) Inhibition of AChE1 in Anopheles gambiae head extract using acetylthiocholine iodide as substrate measured over 60 secs by Ellman's method
ChEMBL_1684531 (CHEMBL4035010) Inhibition of AChE1 in Anopheles gambiae body extract using acetylthiocholine iodide as substrate measured over 60 secs by Ellman's method
ChEMBL_1700230 (CHEMBL4051212) Inhibition of HDAC 1 in human HeLa nuclear extract using HDAC substrate-3 measured after 60 mins by fluorometric analysis
ChEMBL_1700231 (CHEMBL4051213) Inhibition of HDAC 2 in human HeLa nuclear extract using HDAC substrate-3 measured after 60 mins by fluorometric analysis
ChEMBL_1700232 (CHEMBL4051214) Inhibition of HDAC 3 in human HeLa nuclear extract using HDAC substrate-3 measured after 60 mins by fluorometric analysis
ChEMBL_2030958 (CHEMBL4685116) Inhibition of HDAC in human HeLa cell nuclear extract using fluorescence substrate incubated for 30 mins by fluorescence based assay
ChEMBL_2032352 (CHEMBL4686510) Inhibition of tissue extract derived mEH (unknown origin) using [3H]trans-stilbene oxide as substrate by liquid scintillation counting method
ChEMBL_2119132 (CHEMBL4828198) Inhibition of PI3Kdelta in human HL-60 cell extract measured after 2 hrs by kinobeads based chemoproteomic competition binding assay
ChEMBL_2119133 (CHEMBL4828199) Inhibition of VPS34 in human HL-60 cell extract measured after 2 hrs by kinobeads based chemoproteomic competition binding assay
ChEMBL_809835 (CHEMBL2014772) Inhibition of HDAC6 in human HeLa cells nuclear extract using Fluor-de-Lys as substrate after 30 mins by spectrophotometry
ChEMBL_812542 (CHEMBL2014417) Inhibition of HDAC1 in human HeLa cells nuclear extract using Fluor-de-Lys as substrate after 30 mins by spectrophotometry
ChEMBL_89193 (CHEMBL701145) Inhibitory activity evaluated for soluble cell extract of human Inducible nitric oxide synthase and partially purified by DEAE-sepharose chromatography
ChEMBL_974420 (CHEMBL2412317) Inhibition of HDAC in human HeLa cell extract using fluor de Lys as substrate after 15 mins by fluorometric analysis
ChEMBL_54532 (CHEMBL664849) Affinity for DNA-dependent protein kinase(DNA-PK) from HeLa cell extract
ChEMBL_769098 (CHEMBL1832655) Inhibition of STAT3 in mouse NIH3T3/vSrc nuclear extract assessed as disruption of the Stat3-DNA complex pre-incubated for 30 mins by EMSA analysis
ChEBML_1572320 Inhibition of HDAC in human HeLa nuclear extract using BOC-Ac-Lys-AMC as substrate incubated for 90 mins by fluorescence assay
ChEMBL_1282340 (CHEMBL3100391) Inhibition of HDAC in human HeLa cell nuclear extract using fluor de Lys as substrate after 15 mins by fluorimetric analysis
ChEMBL_1551034 (CHEMBL3761048) Inhibition of HDAC in human HeLa cell nuclear extract using BML-KI104 Fluor de Lys as substrate by fluorescence-based assay
ChEMBL_1551259 (CHEMBL3761968) Inhibition of HDAC in human HeLa cells nuclear extract using Fluor de lys as substrate after 15 mins by fluorometric analysis
ChEMBL_1570662 (CHEMBL3795030) Inhibition of HDAC in human HeLa nuclear extract using fluor de lys as substrate after 10 to 15 mins by spectrofluorometry
ChEMBL_1919885 (CHEMBL4422730) Inhibition of HDAC in human HeLa nuclear extract using Fluor-de-lys as substrate measured after 60 mins by fluorescence assay
ChEMBL_1919886 (CHEMBL4422731) Inhibition of HDAC in human HeLa cytosolic extract using Fluor-de-lys as substrate measured after 60 mins by fluorescence assay
ChEMBL_2131671 (CHEMBL4841186) Inhibition of HDAC in human HeLa nuclear extract using Fluor de Lys as substrate incubated for 20 mins by fluorometric assay
ChEMBL_2224455 (CHEMBL5137968) Inhibition of HDAC6 derived from human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate by fluorescence based assay
ChEMBL_2224456 (CHEMBL5137969) Inhibition of HDAC1 derived from human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate by fluorescence based assay
ChEMBL_2337887 Inhibition of HDAC in human nuclear extract using Ac-Arg-Gly-Lys(Ac)-AMC as substrate incubated overnight by fluorescence based assay
ChEMBL_2492889 Inhibition of HDAC1 derived from human HeLa cell extract using Ac-Leu-Gly-Lys (Ac)-AMC as substrate by fluorescence based assay
ChEMBL_2492890 Inhibition of HDAC2 derived from human HeLa cell extract using Ac-Leu-Gly-Lys (Ac)-AMC as substrate by fluorescence based assay
ChEMBL_2492891 Inhibition of HDAC3 derived from human HeLa cell extract using Ac-Leu-Gly-Lys (Ac)-AMC as substrate by fluorescence based assay
ChEMBL_2492892 Inhibition of HDAC6 derived from human HeLa cell extract using Ac-Leu-Gly-Lys (Ac)-AMC as substrate by fluorescence based assay
ChEMBL_2492893 Inhibition of HDAC7 derived from human HeLa cell extract using Ac-Leu-Gly-Lys (Ac)-AMC as substrate by fluorescence based assay
ChEMBL_809834 (CHEMBL2014771) Inhibition of HDAC3-NCoR2 in human HeLa cells nuclear extract using Fluor-de-Lys as substrate after 30 mins by spectrophotometry
ChEMBL_816565 (CHEMBL2025279) Inhibition of HDAC1 in human HeLa cell nuclear extract using Fluor de Lys as substrate after 15 mins by fluorometric analysis
ChEMBL_816566 (CHEMBL2025280) Inhibition of HDAC6 in human HeLa cell nuclear extract using Fluor de Lys as substrate after 15 mins by fluorometric analysis
ChEMBL_816567 (CHEMBL2025281) Inhibition of HDAC8 in human HeLa cell nuclear extract using Fluor de Lys as substrate after 15 mins by fluorometric analysis
ChEMBL_2310567 Inhibition of recombinant Top1 in Antimony resistant Leishmania donovani BHU575 whole cell extract assessed as relaxation of supercoiled pBluescript SK(+) DNA measured by agarose gel electrophoresis analysis
ChEMBL_87532 (CHEMBL694903) In vitro inhibitory activity against histone deacetylase (HDAC) isolated from HeLa nuclear extract
ChEMBL_87542 (CHEMBL695140) In vitro inhibitory activity against human histone deacetylase (HDAC) using HeLa nuclear extract
ChEMBL_1524328 (CHEMBL3632020) Inhibition of Stat3 dimer DNA binding activity in human U251MG cells nuclear extract after 1.5 hrs by EMSA using radiolabeled probe hSIE
ChEMBL_1524329 (CHEMBL3632021) Inhibition of Stat3 dimer DNA binding activity in human U373MG cells nuclear extract after 1.5 hrs by EMSA using radiolabeled probe hSIE
ChEMBL_1545338 (CHEMBL3751357) Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (Ac)-AMC as substrate after 60 mins by fluorometric analysis
ChEMBL_1545348 (CHEMBL3751367) Inhibition of HDAC1 in human HeLa cell nuclear extract using Boc-Lys (Ac)-AMC as substrate after 60 mins by fluorometric analysis
ChEMBL_1545349 (CHEMBL3751368) Inhibition of HDAC6 in human HeLa cell nuclear extract using Boc-Lys (Ac)-AMC as substrate after 60 mins by fluorometric analysis
ChEMBL_1545404 (CHEMBL3751629) Inhibition of HDAC8 in human HeLa cell nuclear extract using Boc-Lys (Ac)-AMC as substrate after 60 mins by fluorometric analysis
ChEMBL_1572320 (CHEMBL3795851) Inhibition of HDAC in human HeLa nuclear extract using BOC-Ac-Lys-AMC as substrate incubated for 90 mins by fluorescence assay
ChEMBL_1700233 (CHEMBL4051215) Inhibition of HDAC 8 in human HeLa nuclear extract using fluorogenic HDAC class 2A substrate measured after 60 mins by fluorometric analysis
ChEMBL_1700234 (CHEMBL4051216) Inhibition of HDAC 4 in human HeLa nuclear extract using fluorogenic HDAC class 2A substrate measured after 60 mins by fluorometric analysis
ChEMBL_1700235 (CHEMBL4051217) Inhibition of HDAC 5 in human HeLa nuclear extract using fluorogenic HDAC class 2A substrate measured after 60 mins by fluorometric analysis
ChEMBL_1700236 (CHEMBL4051218) Inhibition of HDAC 9 in human HeLa nuclear extract using fluorogenic HDAC class 2A substrate measured after 60 mins by fluorometric analysis
ChEMBL_1700238 (CHEMBL4051220) Inhibition of HDAC 11 in human HeLa nuclear extract using fluorogenic HDAC class 2A substrate measured after 60 mins by fluorometric analysis
ChEMBL_1774366 (CHEMBL4231358) Inhibition of HDAC in human HeLa nuclear extract using Ac-Lys(Ac)-pNA as substrate measured after 30 mins by fluorometric analysis
ChEMBL_1875119 (CHEMBL4376408) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate measured after 30 mins by fluorescence assay
ChEMBL_1919962 (CHEMBL4422807) Inhibition of HDAC2 in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate measured after 30 mins by fluorescence assay
ChEMBL_1919963 (CHEMBL4422808) Inhibition of HDAC6 in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate measured after 30 mins by fluorescence assay
ChEMBL_1919964 (CHEMBL4422809) Inhibition of HDAC8 in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate measured after 30 mins by fluorescence assay
ChEMBL_2197604 (CHEMBL5110120) Inhibition of HDAC1/HDAC2 in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate and measured by fluorometric method
ChEMBL_2224821 (CHEMBL5138334) Displacement of [3H]-acetylated histones HDAC6 derived from human K562 cell nuclear extract incubated for 10 mins by liquid scintillation counting method
ChEMBL_2273494 Inhibition of human recombinant STAT3 assessed as reduction in DNA binding activity with HepG2 nuclear extract incubated for 1 hr by ELISA assay
ChEMBL_881914 (CHEMBL2212517) Inhibition of topoisomerase-1 in human U251 cells assessed as inhibition of hypoxia-induced HIF-1alpha accumulation in nuclear extract after 6 to 24 hrs by immunoblot analysis
ChEMBL_1769411 (CHEMBL4221523) Inhibition of HDAC1/CoREST3 in HEK293 whole cell extract using fluorescent acetylated histone peptide as substrate after 60 mins by fluorescence based assay
ChEMBL_2052178 (CHEMBL4707179) Inhibition of HDAC1 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate measured after 2 hrs by fluorescence based assay
ChEMBL_2224822 (CHEMBL5138335) Displacement of [3H]-acetylated histones from HDAC1 derived from human K562 cell nuclear extract incubated for 10 mins by liquid scintillation counting method
ChEMBL_2224823 (CHEMBL5138336) Displacement of [3H]-acetylated histones from HDAC3 derived from human K562 cell nuclear extract incubated for 10 mins by liquid scintillation counting method
ChEMBL_2452840 Inhibition of HDAC2 in human HeLa cells nuclear extract using BocLys(acetyl)-AMC as substrate incubated for 1 hr by fluorescence plate reader analysis
ChEMBL_2452841 Inhibition of HDAC4 in human HeLa cells nuclear extract using BocLys(acetyl)-AMC as substrate incubated for 1 hr by fluorescence plate reader analysis
ChEMBL_2452842 Inhibition of HDAC7 in human HeLa cells nuclear extract using BocLys(acetyl)-AMC as substrate incubated for 1 hr by fluorescence plate reader analysis
ChEMBL_2452843 Inhibition of HDAC9 in human HeLa cells nuclear extract using BocLys(acetyl)-AMC as substrate incubated for 1 hr by fluorescence plate reader analysis
ChEMBL_2452845 Inhibition of HDAC11 in human HeLa cells nuclear extract using BocLys(acetyl)-AMC as substrate incubated for 1 hr by fluorescence plate reader analysis
ChEMBL_65296 (CHEMBL676785) Inhibitory activity evaluated from soluble cell extract of human endothelia constitutive enzyme (Endothelial nitric oxide synthase) and partially purified by DEAE-sepharose chromatography
ChEMBL_1618726 (CHEMBL3860895) Inhibition of HDAC1/HDAC2 in human HeLa cell nuclear extract preincubated for 20 mins followed by addition of HDAC green as substrate measured after 60 mins by fluorescence analysis
ChEMBL_2114766 (CHEMBL4823707) Inhibition of DNA-PK isolated from human HeLa nuclear extract using full length His-tagged p53 as substrate measured after 75 mins in presence of ATP by HTRF assay
ChEMBL_1590578 (CHEMBL3829047) Inhibition of HDAC in human HeLa cell nuclear extract using Ac-Leu-Gly-Lys (Ac)-AMC as substrate after 30 mins by fluorescence assay
ChEMBL_809836 (CHEMBL2014773) Inhibition of HDAC8 in human HeLa cells nuclear extract using Arg-His-Lys(Ac)-Lys(Ac)-AMC as substrate after 30 mins by spectrophotometry
ChEMBL_1663210 (CHEMBL4012891) Binding affinity to TNKS1 in human HeLa cell extract after 2 hrs by HTS assay
ChEMBL_2067854 (CHEMBL4723107) Inhibition of tyrosinase in human HBL cell extract using L-DOPA as substrate measured every 10 mins for 1 hr by MBTH based spectrophotometric method
ChEMBL_2171587 (CHEMBL5056721) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as fluorogenic substrate measured after 1 hr by flourescence plate reader method
ChEMBL_653215 (CHEMBL1226418) Inhibition of eIF4A-mediated cap-dependent protein synthesis in FF-HCV-Ren mRNA transfected Swiss mouse Krebs2 cell extract by [35S]methionine metabolic labeling study
ChEMBL_1663203 (CHEMBL4012884) Binding affinity to PARP1 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
ChEMBL_1663204 (CHEMBL4012885) Binding affinity to PARP2 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
ChEMBL_1663205 (CHEMBL4012886) Binding affinity to PARP4 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
ChEMBL_1663206 (CHEMBL4012887) Binding affinity to PARP11 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
ChEMBL_1663208 (CHEMBL4012889) Binding affinity to PARP14 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
ChEMBL_1663209 (CHEMBL4012890) Binding affinity to PARP16 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
ChEMBL_1663213 (CHEMBL4012894) Binding affinity to PARP10 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
ChEMBL_2232525 (CHEMBL5146297) Inhibition of CDK2 (unknown origin) in baculovirus infected Sf9 insect cell extract using histone H1 as substrate incubated for 10 mins in presence of [gamma-32P]ATP by radiometric scintillation assay
ChEMBL_1437098 (CHEMBL3381112) Inhibition of HDAC1/HDAC2 in human HeLa cell extract incubated for 5 mins prior to substrate addition measured after 30 mins by microtitre plate reader analysis
ChEMBL_1634410 (CHEMBL3877202) Inhibition of immobilized N-LY294002 bead binding to BRD2 (unknown origin) expressed in HEK293T cell nuclear extract incubated for 1 hr by LC-MS/MS analysis
ChEMBL_1634411 (CHEMBL3877203) Inhibition of immobilized N-LY294002 bead binding to BRD3 (unknown origin) expressed in HEK293T cell nuclear extract incubated for 1 hr by LC-MS/MS analysis
ChEMBL_1763006 (CHEMBL4198253) Inhibition of HDAC1/2 in human K562 nuclear extract using (QSY-7)-RGGRGLGK(Ac)-GGARRHRK(TAMRA)NH2 as substrate incubated for 30 mins by fluorescence assay
ChEMBL_984068 (CHEMBL2434426) Inhibition of GST-tagged full length XIAP (unknown origin) assessed as caspase 3/7 reactivation in S-100 cell extract after 4 hrs by fluorescence assay
ChEMBL_1477045 (CHEMBL3428001) Inhibition of HDAC in human HeLa cell nuclear extract using Fluor de Lys as substrate incubated with compound for 30 mins by microtiter-plate reading flourimeter analysis
ChEMBL_1763011 (CHEMBL4198258) Inhibition of HDAC in human HeLa nuclear extract preincubated for 10 mins followed by Boc-Lys(acetyl)-AMC substrate addition measured after 30 mins by fluorescence assay
Enzyme Activity Assay α-Amylase activity was assayed with the chromogenic substrate RBB-starch. An enzyme aliquot was incubated (20 min, 26°C) with 0.3% RBB-starch in 0.1 M Britton-Robinson buffer at the pH optimum of the enzyme (6.5 for Aca s 4 and A. siro extract, 7.0 for D. farinae extract, 6.9 for PPA) or at pH 4.5-9.0 (pH profiling). The reaction was stopped with 0.2 M NaOH, the mixture was centrifuged (10000 g, 10 min), and the absorbance at 620 nm of the supernatant was measured against a control sample (incubated in the absence of enzyme/extract).
ChEMBL_1555945 (CHEMBL3767300) Inhibition of HDAC1/HDAC2 in human HeLa cells nuclear extract preincubated for 5 mins before Boc-Lys (acetyl)-AMC substrate addition for 30 mins by microplate reader analysis
ChEMBL_1835547 (CHEMBL4335680) Inhibition of TNF alpha stimulated NF-KappaB p65 in human HeLa nuclear extract assessed as decrease in NF-KappaB translocation to nucleus measured after 5 hrs by ELISA
ChEMBL_1913618 (CHEMBL4416201) Binding affinity to CDPK4 in Plasmodium falciparum 3D7 blood stage extract incubated for 1 hr in presence of ATP-competitive kinase inhibitor by kinobeads based pull down assay
ChEMBL_1913620 (CHEMBL4416203) Binding affinity to CDPK1 in Plasmodium falciparum 3D7 blood stage extract incubated for 1 hr in presence of ATP-competitive kinase inhibitor by kinobeads based pull down assay
ChEMBL_2260085 (CHEMBL5215096) Inhibition of HDAC1 in human HeLa cell nuclear extract using Bos-Lys(acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition incubated for 30 mins
ChEBML_1769460 Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys-(Ac)-AMC as substrate preincubated for 15 mins followed by substrate addition measured after 60 mins by fluorescence assay
ChEMBL_1432943 (CHEMBL3383918) Inhibition of 5-LO in human PMNL S100 extract using arachidonic acid as substrate incubated for 15 mins prior to substrate addition measured after 10 mins by HPLC analysis
ChEMBL_2057508 (CHEMBL4712509) Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubated for 30 mins followed by hSIE probe addition by EMSA analysis
ChEMBL_2093845 (CHEMBL4775108) Inhibition of human HeLa nuclear extract derived ATM using glutathioneS-transferase-p53N66 as substrate preincubated for 10 mins followed by ATP addition and measured after 1 hr by ELISA
ChEMBL_2277623 Inhibition of human HDAC4 in HeLa cells extract incubated for 5 mins followed by substrate addition and measured after 15 mins using Fluor-de-Lys as substrate by spectrofluorometric analysis
ChEMBL_2277624 Inhibition of human HDAC2 in HeLa cells extract incubated for 5 mins followed by substrate addition and measured after 15 mins using Fluor-de-Lys as substrate by spectrofluorometric analysis
ChEMBL_2277625 Inhibition of human HDAC7 in HeLa cells extract incubated for 5 mins followed by substrate addition and measured after 15 mins using Fluor-de-Lys as substrate by spectrofluorometric analysis
ChEMBL_2277626 Inhibition of human HDAC8 in HeLa cells extract incubated for 5 mins followed by substrate addition and measured after 15 mins using Fluor-de-Lys as substrate by spectrofluorometric analysis
ChEMBL_1825526 (CHEMBL4325290) Binding affinity to PI3Kdelta in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
ChEMBL_1825527 (CHEMBL4325291) Binding affinity to VPS34 in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
ChEMBL_1825557 (CHEMBL4325321) Binding affinity to PI3Kalpha in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
ChEMBL_1825558 (CHEMBL4325322) Binding affinity to PI3Kbeta in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
ChEMBL_1825559 (CHEMBL4325323) Binding affinity to PI3Kgamma in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
ChEMBL_1444367 (CHEMBL3372358) Inhibition of HDAC in human HeLa cell extract using Boc-Lys (acetyl)-AMC as substrate incubated for 10 mins prior to substrate addition measured after 30 mins by fluorescence assay
ChEMBL_1634379 (CHEMBL3877171) Inhibition of immobilized N-LY294002 bead binding to C-terminal Flag-tagged BRD4 (unknown origin) expressed in HEK293T cell nuclear extract incubated for 1 hr by LC-MS/MS analysis
ChEMBL_1769460 (CHEMBL4221572) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys-(Ac)-AMC as substrate preincubated for 15 mins followed by substrate addition measured after 60 mins by fluorescence assay
ChEMBL_1784393 (CHEMBL4255910) Inhibition of STAT3 DNA binding activity in mouse NIH/3T3 nuclear extract preincubated for 30 mins followed by [32P]hSIE addition measured after 30 mins by electrophoretic mobility shift assay
ChEMBL_1797560 (CHEMBL4269677) Inhibition of ATR in human HeLa cell nuclear extract using GST-fused p53N66 as substrate preincubated for 10 mins followed by ATP addition and measured after 1 hr by ELISA
ChEMBL_1867771 (CHEMBL4368746) Inhibition of HDAC4 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorometric assay
ChEMBL_1867772 (CHEMBL4368747) Inhibition of HDAC5 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorometric assay
ChEMBL_1867773 (CHEMBL4368748) Inhibition of HDAC7 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorometric assay
ChEMBL_1867774 (CHEMBL4368749) Inhibition of HDAC9 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorometric assay
ChEMBL_1867775 (CHEMBL4368750) Inhibition of HDAC6 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorometric assay
ChEMBL_2057507 (CHEMBL4712508) Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract preincubated for 30 mins followed by hSIE probe addition by EMSA analysis
ChEMBL_2197605 (CHEMBL5110121) Inhibition of HDAC1 in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(triflouroacetyl)-AMC as substrate incubated for 30 mins and measured by fluorescence assay
ChEMBL_2197606 (CHEMBL5110122) Inhibition of HDAC6 in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(triflouroacetyl)-AMC as substrate incubated for 30 mins and measured by fluorescence assay
ChEMBL_2197607 (CHEMBL5110123) Inhibition of HDAC8 in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(triflouroacetyl)-AMC as substrate incubated for 30 mins and measured by fluorescence assay
ChEMBL_1895949 (CHEMBL4397984) Inhibition of HDAC in human HeLa cell nuclear extract assessed as decrease in deacetylation of FLUOR DE LYS Green substrate preincubated for 10 mins followed by substrate addition and measured after 30 mins by fluorescence based assay
ChEMBL_1763428 (CHEMBL4198675) Inhibition of HDAC1/2 in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorescence assay
ChEMBL_1769470 (CHEMBL4221582) Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (acetyl)-AMC as substrate preincubated for 10 mins followed by substrate addition measured after 30 mins by fluorescence assay
ChEMBL_1769471 (CHEMBL4221583) Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorescence assay
ChEMBL_1781393 (CHEMBL4252910) Inhibition of HDAC in human HeLa cell extract using Fluor de Lys-Green as substrate preincubated for 5 mins followed by substrate addition and measured after 1 hr by fluorescence assay
ChEMBL_1847057 (CHEMBL4347598) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
ChEMBL_1936352 (CHEMBL4482111) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate preincubated for 10 mins followed by substrate addition and measured after 30 mins by fluorescence assay
ChEMBL_1936353 (CHEMBL4482112) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
ChEMBL_830578 (CHEMBL2061433) Inhibition of human Tdp1 in Tdp1-deficient chicken DT40 whole cell extract using 5'-[32P]-labeled single-stranded DNA oligonucleotide containing 3'-phosphotyrosine as substrate after 15 mins by PAGE analysis
ChEMBL_1913617 (CHEMBL4416200) Binding affinity to CDPK4 in Plasmodium falciparum 3D7 blood stage extract incubated for 1 hr by kinobeads based pull down assay
ChEMBL_1913619 (CHEMBL4416202) Binding affinity to CDPK1 in Plasmodium falciparum 3D7 blood stage extract incubated for 1 hr by kinobeads based pull down assay
ChEMBL_1913623 (CHEMBL4416206) Binding affinity to CK1 in Plasmodium falciparum 3D7 blood stage extract incubated for 1 hr by kinobeads based pull down assay
ChEMBL_1551388 (CHEMBL3762509) Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 15 mins followed by substrate addition measured after 60 mins by fluorescence-based assay
ChEMBL_1683516 (CHEMBL4033995) Inhibition of HDAC1/2 in human HeLa cell nuclear extract using COLOR DE LYS as substrate pretreated for 5 mins followed by substrate addition measured after 30 mins by UV-absorption method
ChEMBL_1893047 (CHEMBL4394968) Inhibition of HDAC in human HeLa cell nuclear extract using fluor-de-lys-green as substrate preincubated for 10 mins followed by substrate addition and measured after 30 mins by fluorescence assay
ChEMBL_2057493 (CHEMBL4712494) Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT3 SH2 domain in mouse NIH3T3/v-Src nuclear extract preincubated for 30 mins followed by hSIE probe addition by EMSA analysis
ChEMBL_2213936 (CHEMBL5127068) Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by microplate reader analysis
ChEMBL_2268733 Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence based analysis
ChEMBL_2268738 Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (acetyl)-AMC as substrate preincubated for 15 mins followed by substrate addition and measured after 60 mins by fluorescence based analysis
ChEMBL_2273479 Inhibition of recombinant STAT3 (unknown origin) expressed in baculovirus in Sf9 insect cells assessed as reduction in DNA binding activity with NIH3T3 nuclear extract incubated for 30 mins by electrophoretic mobility shift assay
ChEMBL_2488040 Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 15 mins followed by substrate addition and measured after 60 mins by fluorescence based analysis
ChEMBL_1553268 (CHEMBL3767500) Inhibition of HDAC1/2 in human HeLa cell nuclear extract using color de Lys as substrate preincubated for 5 mins followed by substrate addition measured after 30 min by microtiter plate reader analysis
ChEMBL_1750439 (CHEMBL4185199) Inhibition of HDAC1 in Plasmodium falciparum 3D7 nuclear extract using Ac-RGK(Ac)-AMC fluorogenic peptide as substrate preincubated for 1 hr followed by substrate addition measured after 10 min by fluorescence assay
ChEMBL_1760362 (CHEMBL4195370) Inhibition of HDAC in human HeLa cell nuclear extract using fluorogenic Boc-Lys(acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorescence-based assay
ChEMBL_2050950 (CHEMBL4705649) Inhibition of FAM-Bim peptide binding to human full-length N-terminal His6-tagged Bcl2 (2 to 206 residues) expressed in Escherichia coli S12 extract measured after 30 mins by fluorescence polarization assay
ChEMBL_2031685 (CHEMBL4685843) Inhibition of class 1 HDAC in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
ChEMBL_2273504 Inhibition of recombinant STAT3 (unknown origin) expressed in Escherichia coli BL21 (DE3) cells assessed as reduction in DNA binding activity with SK-MEL-5 nuclear extract incubated for 30 mins by electrophoretic mobility shift assay
ChEMBL_2475467 Inhibition of C-terminal 6His-tagged recombinant human STAT3 (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 10 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
ChEMBL_2475468 Inhibition of C-terminal 6His-tagged recombinant human STAT3 (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
ChEMBL_2475469 Inhibition of C-terminal 6His-tagged recombinant human STAT3 (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 60 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
ChEMBL_2298866 Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(Tfa)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
ChEMBL_2496980 Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(Tfa)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
ChEMBL_2496998 Inhibition of HDAC1 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(Tfa)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
ChEMBL_2496999 Inhibition of HDAC2 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(Tfa)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
ChEMBL_2497000 Inhibition of HDAC3 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(Tfa)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
ChEMBL_887090 (CHEMBL2214315) Inhibition of Apaf-1-caspase 9-cytochrome c-caspase 3 complex in human HEK293 cytosolic extract using afc-DEVD as substrate preincubated for 30 mins before substrate addition measured after 30 mins by fluorescence assay
ChEMBL_2018354 (CHEMBL4671932) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC or Boc-Lys (triflouroacetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
ChEMBL_2260034 (CHEMBL5215045) Inhibition of HDAC-1 (unknown origin) expressed in Escherichia coli BL21 (DE3) in HeLa nuclear extract using KI177 as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by Bradford reagent method
ChEMBL_2050946 (CHEMBL4705645) Binding affinity to human full-length N-terminal His6-tagged Bcl2 (2 to 206 residues) expressed in Escherichia coli S12 extract by isothermal titration calorimetry
ChEMBL_34793 (CHEMBL643770) In vitro inhibitory activity against Angiotensin I converting enzyme (ACE) isolated from rabbit lung extract using hippuryl-L-histidyl-L-leucine (HHL) as the substrate
ChEMBL_1738015 (CHEMBL4153765) Inhibition of ATM derived from human HeLa cell nuclear extract using glutathione S-transferase p53N66 as substrate preincubated for 10 mins followed by ATP addition and subsequent incubation for 1 hr measured after 1.5 hrs by ELISA
ChEMBL_2475470 Inhibition of recombinant wild type tyrosine phosphorylated C-terminal 6His tagged human STAT3 (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
ChEMBL_2260035 (CHEMBL5215046) Inhibition of HDAC-6 (unknown origin) expressed in Escherichia coli BL21 (DE3) in HeLa nuclear extract using Boc-Lys(TFA)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by Bradford reagent method
ChEMBL_2050947 (CHEMBL4705646) Binding affinity to human full-length N-terminal His6-tagged prephosphorylated Bcl2 (2 to 206 residues) expressed in Escherichia coli S12 extract by isothermal titration calorimetry
ChEMBL_2475471 Inhibition of recombinant wild type tyrosine phosphorylated C-terminal 6His tagged human STAT3 C328A mutant (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
ChEMBL_2475472 Inhibition of recombinant wild type tyrosine phosphorylated C-terminal 6His tagged human STAT3 C426A mutant (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
ChEMBL_2475473 Inhibition of recombinant wild type tyrosine phosphorylated C-terminal 6His tagged human STAT3 C468A mutant (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
ChEMBL_2475474 Inhibition of recombinant wild type tyrosine phosphorylated C-terminal 6His tagged human STAT3 C542S mutant (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
Enzyme Assay ATR for use in the in vitro enzyme assay was obtained from HeLa nuclear extract (CIL Biotech, Mons, Belgium) by immunoprecipitation with rabbit polycolonal antiserum raised to amino acids 400-480 of ATR (Tibbetts R S et, al, 1999, GenesDev.13:152-157).
Biological Assay For mTOR enzyme activity assays, mTOR protein was isolated from HeLa cell cytoplasmic extract by immunoprecipitation, and activity determined essentially as described previously using recombinant PHAS-1as a substrate (ref 21).
ChEMBL_2050942 (CHEMBL4705641) Binding affinity to human full-length N-terminal His6-tagged Bcl2 (2 to 206 residues) expressed in Escherichia coli S12 extract after 30 mins using FAM-labelled compound by fluorescence polarization assay
Fluor de Lys Assay Fluor de Lys is a fluorescence based HDAC activity assay comprising a combination of fluorogenic Histone deAcetylase Lysyl substrate and a developer. The kit is a highly sensitive and convenient alternative to radiolabeled, acetylated histones or peptide/HPLC methods for the assay of histone deacetylases. This assay is based on the ability of HeLa nuclear extract, which is enriched in HDAC activity, to mediate the deacetylation of the acetylated lysine side chain of the Fluor de Lys substrate. The assay procedure requires two steps. First, incubation of the HeLa nuclear extract with the Fluor de Lys substrate results in substrate deacetylation and thus sensitizes it to the second step. In the second step, treatment of the deacetylated substrate with the Fluor de Lys developer produces a fluorophore. The substrate-developer reaction, under normal circumstances goes to completion in less than 1 min at 25 C.
HDAC enzyme inhibitionAssay HDAC enzyme inhibition assays were performed using purified HDACs 1-10 essentially as described in Beckers et al., 2007, Int. J. Cancer., 121:1138-48 and Perez-Balado et al., 2007, J. Med. Chem., 50:2497-2505. Inhibition assays using nuclear extract were performed essentially as described in Herman et al., 2006, Nat. Chem. Biol., 2:551-558. Briefly, the purified HDACs or nuclear extract were incubated with an acetylated substrate in the absence of the compound to be assayed and with increasing concentrations of the compound. The rate of substrate deacetylation was measured under each condition, and half-maximal inhibitory concentration with regard to each HDAC was determined by standard means.
ChEMBL_2050943 (CHEMBL4705642) Binding affinity to human full-length N-terminal His6-tagged prephosphorylated Bcl2 (2 to 206 residues) expressed in Escherichia coli S12 extract after 30 mins using FAM-labelled compound by fluorescence polarization assay
PDE3A Enzyme Inhibition Assay For the determination of the in vitro effect of example compounds on the PDE3A reactions 2 μl of the respective example compound solution in DMSO (serial dilutions) were placed in wells of microtiter plates (Isoplate-96/200W; Perkin Elmer). 50 μl of a dilution of PDE3A cell extract from Sf9 cells overexpressing human full length PDE3A (SB Drug Discovery, UK) in buffer A (50 mM Tris/HCl pH 7.5, 8.3 mM MgCl2, 1.7 mM EDTA, 0.2% BSA) was added. The dilution of the PDE3A cell extract was chosen such that the reaction kinetics was linear and less than 70% of the substrate was consumed (typical dilution 1:5000). The reaction was started by addition of 50 μl (0.025 μCi) of 1:2000 in buffer A w/o BSA diluted substrate [8-3H]adenosine 3′, 5′-cyclic phosphate (1 μCi/μl; Perkin Elmer). After incubation at room temperature for 60 min, the reaction was stopped by addition of 25 μl of a suspension containing 18 mg/ml yttrium scintillation proximity beads (Perkin Elmer) in water. The microtiter plates were sealed and measured in a Microbeta scintillation counter (PerkinElmer Wallac).
Enzyme inhibition assay The nucleus extract was extracted from HDAC8 enzyme was expressed in Escherichia coli. Boc-Lys (acetyl)-AMC was used as the substrate of HDAC. SAHA which is the HDAC inhibitor on market was used as a positive control. The compounds were diluted to six concentrations (25, 5, 1, 0.2, 0.04 and 0.008 uM/L) to investigate their ability of inhibiting HDAC activity.
Electrophoretic Mobility Shift Assay (EMSA) His10-Stat3 was expressed in Sf9 cells from a baculovirus encoding the recombinant protein. A nuclear extract of the Sf9 cells was incubated with 32P-labeled high affinity c-fos sis inducible element (hSIE) either alone or in the presence of inhibitor. After 20 min of incubation, samples were electrophoresed on polyacrylamide gels. The gels were dried, exposed to a phosphorimager screen and scanned. IC50 values were derived from plots of spot intensity versus phosphopeptide concentration. The affinity of peptides to the SH2 domain is measured by the intensity of the radioactivity of the Stat3-DNA complex band in the electrophoresis gel.
Biological Activity Assay The KDM1A demethylase enzyme activity can obtained from mammalian cells or tissues expressing KDM1A from an endogenous or recombinant gene and purified or assayed from a whole cell extract. These methods can be used to determine the concentration of the disclosed compounds can inhibit fifty percent of the enzyme activity (IC50). In one aspect, the disclosed compounds exhibit inhibition fifty percent of the KDM1A enzyme activity at a concentration of less than 500 nM, less than 100 nM, less than 50 nM or less than 10 nM.
Electrophoretic Mobility Shift Assay (EMSA) STAT proteins were expressed in Sf9 cells from a baculovirus encoding the recombinant protein. A nuclear extract of the Sf9 cells was incubated with 32P-labeled high affinity c-fos sis inducible element (hSIE) either alone or in the presence of inhibitor. After incubation, samples were electrophoresed on polyacrylamide gels. The gels were dried, exposed to a phosphorimager screen and scanned. IC50 values were derived from plots of spot intensity versus phosphopeptide concentration. The affinity of peptides to the SH2 domain is measured by the intensity of the radioactivity of the Stat-DNA complex band in the electrophoresis gel.
PDE3B Enzyme Inhibition Assay The commercially available 3H-cAMP Scintillation Proximity Assay (SPA, Perkin Elmer) system was used for enzyme inhibition studies. For the determination of the in vitro effect of example compounds on the PDE3B reactions 2 μl of the respective example compound solution in DMSO (serial dilutions) were placed in wells of microtiter plates (Isoplate-96/200W; Perkin Elmer). 50 μl of a dilution of PDE3B cell extract from Sf9 cells overexpressing human full length PDE3B (SB Drug Discovery, UK) in buffer A (50 mM Tris/HCl pH 7.5, 8.3 mM MgCl2, 1.7 mM EDTA, 0.2% BSA) was added. The dilution of the PDE3B cell extract was chosen such that the reaction kinetics was linear and less than 70% of the substrate was consumed (typical dilution 1:6000). The reaction was started by addition of 50 μl (0.025 μCi) of 1:2000 in buffer A w/o BSA diluted substrate [8-3H]adenosine 3′, 5′-cyclic phosphate (1 μCi/μl; Perkin Elmer). After incubation at room temperature for 60 min, the reaction was stopped by addition of 25 μl of a suspension containing 18 mg/ml yttrium scintillation proximity beads (Perkin Elmer) in water. The microtiter plates were sealed and measured in a Microbeta scintillation counter (PerkinElmer Wallac). IC50 values were determined from sigmoidal curves by plotting percentage PDE3B activity vs log compound concentration.
In Vitro Inhibition Assay This work was performed at the MDS Pharma Services, Pharmacology Laboratories, Taiwan. The assay was an in vitro evaluation of the ability of an extract or a pure compound to inhibit the steroid 5alpha -reductase enzyme from metabolizing testosterone into dihydrotestosterone. This is an enzyme-immunoassay (EIA) for quantitative determination of testosterone in human serum or plasma. The significance of this type of inhibition is that it can lead to eradication of benign prostatic hyperplasia (BPH). Two distinct isozymes are found in mice, rats, monkeys and humans: type 1 and II. Each of these isozymes is differentially expressed in tissues and developmental stages. In human, type 1 steroid 5alpha -reductase is predominant in the sebaceous glands of most regions of skin, including scalp and liver and is responsible for approximately one third of circulating DHT. Inhibitors of steroid 5alpha -reductase may be of benefit in the treatment of androgenetic alopecia.
FASN Inhibition FASN activity of the SKBr3 cell extract was determined by measuring either NADPH oxidation or the amount of thiol-containing coenzyme A (CoA) released during the fatty acid synthase reaction. The dye CPM (7-diethylamino-3-(4′-maleimidyl-phenyl)-4-methylcoumarin) contains a thiol reactive group that increases its fluorescence emission on reaction with the sulfhydryl group of CoA. The biochemical activities shown in TABLE 31 were determined using the fluorescence measurement of CoA release via a procedure described in Chung C. C. et al. (Assay and Drug Development Technologies, 2008, 6(3), 361-374).
PDE3A Enzyme Inhibition The commercially available 3H-cAMP Scintillation Proximity Assay (SPA, Perkin Elmer) system was used for enzyme inhibition studies. For the determination of the in vitro effect of example compounds on the PDE3A reactions 2 μl of the respective example compound solution in DMSO (serial dilutions) were placed in wells of microtiter plates (Isoplate-96/200W; Perkin Elmer). 50 μl of a dilution of PDE3A cell extract from Sf9 cells overexpressing human full length PDE3A (SB Drug Discovery, UK) in buffer A (50 mM Tris/HCl pH 7.5, 8.3 mM MgCl2, 1.7 mM EDTA, 0.2% BSA) was added. The dilution of the PDE3A cell extract was chosen such that the reaction kinetics was linear and less than 70% of the substrate was consumed (typical dilution 1:5000). The reaction was started by addition of 50 μl (0.025 μCi) of 1:2000 in buffer A w/o BSA diluted substrate [8-3H]adenosine 3′, 5′-cyclic phosphate (1 μCi/μl; Perkin Elmer). After incubation at room temperature for 60 min, the reaction was stopped by addition of 25 μl of a suspension containing 18 mg/ml yttrium scintillation proximity beads (Perkin Elmer) in water. The microtiter plates were sealed and measured in a Microbeta scintillation counter (PerkinElmer Wallac). IC50 values were determined from sigmoidal curves by plotting percentage PDE3A activity vs log compound concentration.
PDE3A Enzyme Inhibition The commercially available 3H-cAMP Scintillation Proximity Assay (SPA, Perkin Elmer) system was used for enzyme inhibition studies. For the determination of the in vitro effect of test substances on the PDE3A reactions 2 μl of the respective test compound solution in DMSO (serial dilutions) were is placed in wells of microtiter plates (Isoplate-96/200W; Perkin Elmer). 50 μl of a dilution of PDE3A cell extract from Sf9 cells overexpressing human full length PDE3A (SB Drug Discovery, UK) in buffer A (50 mM Tris/HCl pH 7.5, 8.3 mM MgCl2, 1.7 mM EDTA, 0.2% BSA) was added. The dilution of the PDE3A cell extract was chosen such that the reaction kinetics was linear and less than 70% of the substrate was consumed (typical dilution 1:5000). The reaction was started by addition of 50 μl (0.025 μCi) of 1:2000 in buffer A w/o BSA diluted substrate [8-3H] adenosine 3′,5′-cyclic phosphate (1 μCi/μl; Perkin Elmer). After incubation at room temperature for 60 min, the reaction was stopped by addition of 25 μl of a suspension containing 18 mg/ml yttrium scintillation proximity beads (Perkin Elmer) in water. The microtiter plates were sealed and measured in a Microbeta scintillation counter (PerkinElmer Wallac). IC50 values were determined from sigmoidal curves by plotting percentage PDE3A activity vs log compound concentration.
PDE3B Enzyme Inhibition The commercially available 3H-cAMP Scintillation Proximity Assay (SPA, Perkin Elmer) system was used for enzyme inhibition studies. For the determination of the in vitro effect of example compounds on the PDE3B reactions 2 μl of the respective example compound solution in DMSO (serial dilutions) were placed in wells of microtiter plates (Isoplate-96/200W; Perkin Elmer). 50 μl of a dilution of PDE3B cell extract from Sf9 cells overexpressing human full length PDE3B (SB Drug Discovery, UK) in buffer A (50 mM Tris/HCl pH 7.5, 8.3 mM MgCl2, 1.7 mM EDTA, 0.2% BSA) was added. The dilution of the PDE3B cell extract was chosen such that the reaction kinetics was linear and less than 70% of the substrate was consumed (typical dilution 1:6000). The reaction was started by addition of 50 μl (0.025 μCi) of 1:2000 in buffer A w/o BSA diluted substrate [8-3H]adenosine 3′, 5′-cyclic phosphate (1 μCi/μl; Perkin Elmer). After incubation at room temperature for 60 min, the reaction was stopped by addition of 25 μl of a suspension containing 18 mg/ml yttrium scintillation proximity beads (Perkin Elmer) in water. The microtiter plates were sealed and measured in a Microbeta scintillation counter (PerkinElmer Wallac). IC50 values were determined from sigmoidal curves by plotting percentage PDE3B activity vs log compound concentration.
PDE3B Enzyme Inhibition The commercially available 3H-cAMP Scintillation Proximity Assay (SPA, Perkin Elmer) system was used for enzyme inhibition studies. For the determination of the in vitro effect of test substances on the PDE3B reactions 2 μl of the respective test compound solution in DMSO (serial dilutions) were placed in wells of microtiter plates (Isoplate-96/200W; Perkin Elmer). 50 μl of a dilution of PDE3B cell extract from Sf9 cells overexpressing human full length PDE3B (SB Drug Discovery, UK) in buffer A (50 mM Tris/HCl pH 7.5, 8.3 mM MgCl2, 1.7 mM EDTA, 0.2% BSA) was added. The dilution of the PDE3B cell extract was chosen such that the reaction kinetics was linear and less than 70% of the substrate was consumed (typical dilution 1:6000). The reaction was started by addition of 50 μl (0.025 μCi) of 1:2000 in buffer A w/o BSA diluted substrate [8-3H] adenosine 3′,5′-cyclic phosphate (1 μCi/μl; Perkin Elmer). After incubation at room temperature for 60 min, the reaction was stopped by addition of 25 μl of a suspension containing 18 mg/ml yttrium scintillation proximity beads (Perkin Elmer) in water. The microtiter plates were sealed and measured in a Microbeta scintillation counter (PerkinElmer Wallac). IC50 values were determined from sigmoidal curves by plotting percentage PDE3B activity vs log compound concentration.
CB1 and CB2 Binding Inhibition by Compounds Purified from Milicia excelsa (African Teak) The organic extract (8 g) from the stem barks of Milicia excelsa, obtained using the methods described in Example 1, was divided and loaded separately onto two pre-packed flash columns (120 g silica, particle size 32-60 μm, 4 cm×19 cm), then the column was eluted with the gradient as described in Example 5. A Diels-Alder adduct of a chalcone and prenylphenyl moiety was isolated from one of the active fractions and identified as Sanggenon C/D/.
ChEMBL_440740 (CHEMBL888711) Inhibition of human LBD of of ERalpha
RORgamma Gal4 Reporter Gene Assay (FF) Cells were incubated for additional 16 h before firefly (FF) luciferase activities were measured sequentially in the same cell extract using a Dual-Light-Luciferase-Assay system (Dyer et al., Anal. Biochem. 2000, 282:158). All experiments were done at least in triplicates.
RORgamma Gal4 Reporter Gene Assay (REN) Cells were incubated for additional 16 h before renilla (REN) luciferase activities were measured sequentially in the same cell extract using a Dual-Light-Luciferase-Assay system (Dyer et al., Anal. Biochem. 2000, 282:158). All experiments were done at least in triplicates.
In vitro HDACs Inhibition Fluorescence Assay In brief, 10 μL of HeLa nuclear extract was mixed with various concentrations of target compounds (50 μL), SAHA, using 100% and none HDACs groups as control group, and the mixture. After incubation at 37 °C for 10 min, fluorogenic substrate Boc-Lys (acetyl)-AMC (40 μL) was added and then the mixture was incubated at 37 °C for 30 min. The mixture was stopped by addition of 100 μL of developer containing trypsin and TSA afterward. Over the next incubation at 37 °C for 20 min, fluorescence intensity was measured using a microplate reader at excitation and emission wavelengths of 390 and 460 nm, respectively.
ChEBML_209063 Inhibition of amidolytic activity of thrombin
ChEBML_211872 Inhibition of the polymerization of tubulin
ChEMBL_333145 (CHEMBL865913) Inhibition of reuptake of 5HT
ChEMBL_333146 (CHEMBL865923) Inhibition of reuptake of Norepinephrine
ChEMBL_2267427 Inhibition of human cdc7 incubation of 30 mins in presence of ATP
ChEMBL_2267428 Inhibition of human CDK9 incubation of 30 mins in presence of ATP
ChEMBL_66597 (CHEMBL680028) Inhibition of autophosphorylation of cytoplasmic domain of epidermal growth factor receptor
Biological Activity Assay Assaying the inhibition of KDM1A can be determined in vitro, in cultured cells, and in animals. There are a variety of spectrophotometric methods to detect the results of demethylation of methylated lysines, viz., detecting the products of KDM1A demethylase oxidative activity on a peptide fragment of at least 18 amino acid representing the N-terminus of the histone H3 substrate that contains a monomethyl at the fourth lysine residue. Hydrogen peroxide, one product of the KDM1A demethylase reaction, reacts with horseradish peroxidase and dihydroxyphenoxazine (ADHP) to produce the fluorescent compound resorufin (excitation=530-560 nm:emission=590 nm). The KDM1A demethylase enzyme activity can obtained from mammalian cells or tissues expressing KDM1A from an endogenous or recombinant gene and purified or assayed from a whole cell extract. These methods can be used to determine the concentration of the disclosed compounds can inhibit fifty percent of the enzyme activity (IC50). In one aspect, the disclosed compounds exhibit inhibition fifty percent of the KDM1A enzyme activity at a concentration of less than 500 nM, less than 100 nM, less than 50 nM or less than 10 nM.
ChEMBL_184451 (CHEMBL789405) Inhibition of adenosine stimulated accumulation of cyclic AMP at Adenosine A2 receptor of VA13 fibroblasts of rat
Inhibition of Histone Deacetylase Enzymatic Assay For deacetylase assays, 20,000 cpm of the [3H]-metabolically labeled acetylated histone substrate (M. Yoshida et al., J. Biol. Chem. 265(28): 17174-17179 (1990)) is incubated with 30 ug of H446 nuclear extract or an equivalent amount of the cloned recombinant hHDAC-1 for 10 minutes at 37 C. The reaction is stopped by adding acetic acid (0.04 M, final concentration) and HCl (250 mM, final concentration). The mixture is extracted with ethyl acetate and the released [3H]-acetic acid was quantified by scintillation counting. For inhibition studies, the enzyme is preincubated with compounds at 4 C. for 30 minutes prior to initiation of the enzymatic assay. IC50 values for HDAC enzyme inhibitors are determined by performing dose response curves with individual compounds and determining the concentration of inhibitor producing fifty percent of the maximal inhibition. Alternatively, the following protocol is used to assay the compounds of the invention.
ChEBML_155363 Inhibition of phosphodiesterase 5 of rabbit platelets
ChEBML_208905 Evaluation of inhibition of transition state thrombin
ChEBML_212014 Tested for inhibition of polymerization of tubulin
ChEBML_305045 Inhibition of Beta-glucosidase of rat intestine
ChEBML_305098 Inhibition of Beta-galactosidase of bovine liver
ChEBML_41589 Inhibition of (BChE) Butyrylcholinesterase of horse serum
ChEMBL_154561 (CHEMBL757896) Inhibition of PDE5 of human platelets
ChEMBL_154562 (CHEMBL757897) Inhibition of PDE5 of human platelets
ChEMBL_2277852 Induction of degradation of FKBP12 (unknown origin)
ChEMBL_2277853 Induction of degradation of USP7 (unknown origin)
ChEMBL_429830 (CHEMBL915411) Inhibition of dimerization of HIV1 protease
ChEMBL_440741 (CHEMBL888712) Inhibition of human LBD of ERbeta
ChEMBL_529187 (CHEMBL974963) Inhibition of peptidase activity of CPP32
ChEMBL_760063 (CHEMBL1810386) Inhibition of auto-phosphorylation of IGFR1
ChEMBL_770210 (CHEMBL1833000) Inhibition of first bromodomain of BRD2
ChEMBL_770211 (CHEMBL1833001) Inhibition of first bromodomain of BRD4
ChEMBL_1513226 (CHEMBL3610934) Inhibition of PAK1 (unknown origin) in presence of 1.5 uM of ATP
ChEMBL_1513227 (CHEMBL3610935) Inhibition of PAK1 (unknown origin) in presence of 15 uM of ATP
ChEMBL_1513228 (CHEMBL3610936) Inhibition of PAK1 (unknown origin) in presence of 150 uM of ATP
ChEMBL_88782 (CHEMBL699440) Inhibitory concentration of compound against strand transfer of of HIV-2 integrase
ChEBML_71792 Inhibition of human GGTase-catalyzed incorporation of [3H]GGPP into biotinylated peptide of C-terminal of human K-Ras
ChEMBL_2127677 (CHEMBL4837022) Inhibition of eIF4A (unknown origin) assessed as inhibition of translation of RNA featuring short 5'-UTR of tubulin
Tyrosinase Inhibition Assay Briefly, mushroom tyrosinase (1250 units/mL) and 2 mM L-tyrosine (0.07 mL) were added to a solution of phosphate buffer (0.1 M, pH 6.8, 0.09 mL) containing the test sample. The test mixture (0.2 mL) was incubated for 10 min at 37°C and the absorption due to the formation of dopachrome was monitored at 475 nm. The same mixture except for the plant extract was used as a control. Arbutin (hydroquinone-O-β-glucopyranoside) was used as a positive control. Each treatment was replicated three times.
ChEMBL_71792 (CHEMBL686003) Inhibition of human GGTase-catalyzed incorporation of [3H]GGPP into biotinylated peptide of C-terminal of human K-Ras
ChEBML_99764 Kinetic constant for inactivation of MAO B from replot of half-lives of inactivation
ChEMBL_1478084 (CHEMBL3430146) Inhibition of human FPPS in absence of pre-incubation of compound with enzyme
ChEMBL_1549975 (CHEMBL3755273) Inhibition of human plasmin assessed as inhibition of fibrinolysis in presence of fibrinogen
ChEMBL_1549976 (CHEMBL3755274) Inhibition of human plasmin assessed as inhibition of fibrinogenolysis in presence of fibrinogen
ChEMBL_1549977 (CHEMBL3755275) Inhibition of human plasmin assessed as inhibition of amidolysis in presence of fibrinogen
ChEMBL_214787 (CHEMBL815524) Inhibition of [3H]nitrendipine binding to membrane homogenates of of rat cardiac muscle.
ChEMBL_2317870 Inhibition of JAK1 JH1 domain (unknown origin) in presence of 1 mM of ATP
ChEMBL_2317871 Inhibition of JAK2 JH1 domain (unknown origin) in presence of 1 mM of ATP
ChEMBL_2317872 Inhibition of JAK3 JH1 domain (unknown origin) in presence of 1 mM of ATP
ChEMBL_2317873 Inhibition of TYK2 JH1 domain (unknown origin) in presence of 1 mM of ATP
ChEMBL_2317874 Inhibition of JAK1 JH1 domain (unknown origin) in presence of 10 uM of ATP
ChEMBL_2317875 Inhibition of JAK2 JH1 domain (unknown origin) in presence of 10 uM of ATP
ChEMBL_2317876 Inhibition of JAK3 JH1 domain (unknown origin) in presence of 10 uM of ATP
ChEMBL_2317877 Inhibition of TYK2 JH1 domain (unknown origin) in presence of 10 uM of ATP
ChEMBL_2317883 Inhibition of TYK2 JH2 domain (unknown origin) in presence of 10 uM of ATP
ChEBML_155549 Inhibition of fraction II of guinea pig phosphodiesterase
ChEBML_208949 Inhibition of Thymidylate synthase of Escherichia coli (Ki)
ChEBML_31924 Inhibition of crude aldose reductase of rat lens
ChEMBL_156175 (CHEMBL760944) Inhibition of phosphodiesterase 1 of bovine heart
ChEMBL_211317 (CHEMBL818977) Inhibition of polymerization of purified bovine tubulin
ChEMBL_2224166 (CHEMBL5137679) Inhibition of phosphorylation of eIF4E (unknown origin)
ChEMBL_2284276 Inhibition of LIMK1 (unknown origin) phosphorylation of cofilin
ChEMBL_2427091 Inhibition of human mTOR in presence of ATP
ChEMBL_2502299 Inhibition of human JNK1 in presence of ATP
ChEMBL_2502300 Inhibition of human JNK2 in presence of ATP
ChEMBL_2502301 Inhibition of human JNK3 in presence of ATP
ChEMBL_2526023 Inhibition of human recombinant intracellular domain of erbB2
ChEMBL_2526024 Inhibition of human recombinant intracellular domain of EGFR
ChEMBL_2543595 Inhibition of human RSK2 in presence of ATP
ChEMBL_2543596 Inhibition of human CHK2 in presence of ATP
ChEMBL_2543597 Inhibition of human FLT3 in presence of ATP
ChEMBL_2543598 Inhibition of human RSK1 in presence of ATP
ChEMBL_2543599 Inhibition of human PKCtheta in presence of ATP
ChEMBL_2543600 Inhibition of human YES1 in presence of ATP
ChEMBL_2543601 Inhibition of human FYN in presence of ATP
ChEMBL_2543605 Inhibition of human SRC in presence of ATP
ChEMBL_2543606 Inhibition of human TRKa in presence of ATP
ChEMBL_2543607 Inhibition of human PKCbeta1 in presence of ATP
ChEMBL_2543608 Inhibition of human PKCmu in presence of ATP
ChEMBL_2543609 Inhibition of human PRKG1 in presence of ATP
ChEMBL_2543611 Inhibition of human PRK1 in presence of ATP
ChEMBL_2543612 Inhibition of human FGR in presence of ATP
ChEMBL_2543613 Inhibition of human PKCgamma in presence of ATP
ChEMBL_2559768 Inhibition of human OPRK1 in presence of GTPgS
ChEMBL_2559769 Inhibition of human OPRM1 in presence of GTPgS
ChEMBL_27816 (CHEMBL636706) Inhibition of Acetylcholinesterase activity of calf forebrain
ChEMBL_28904 (CHEMBL638603) Inhibition of acetylcholinesterase (AChE) of human erythrocytes
ChEMBL_305479 (CHEMBL830270) Inhibition of Mammalian target of Rapamycin mTOR
ChEMBL_330335 (CHEMBL869970) Inhibition of isomerase activity of Cyclophilin A
ChEMBL_359170 (CHEMBL869329) Inhibition of trypsin like activity of proteasome
ChEMBL_359171 (CHEMBL869330) Inhibition of chymotrypsin like activity of proteasome
ChEMBL_361112 (CHEMBL859178) Inhibition of FabG in presence of NADPH
ChEMBL_361956 (CHEMBL859179) Inhibition of SRC in presence of ATP
ChEMBL_453798 (CHEMBL885799) Inhibition of diphenolase activity of mushroom tyrosinase
ChEMBL_473707 (CHEMBL936806) Inhibition of Chk1 mediated phosphorylation of cdc25C
ChEMBL_52852 (CHEMBL664376) Inhibition of Dihydrofolate reductase of Pneumocystis carinii
ChEMBL_52972 (CHEMBL664180) Inhibition of Dihydrofolate Reductase of Pneumocystis carinii.
ChEMBL_53329 (CHEMBL664915) Inhibition of Dihydrofolate reductase of Toxoplasma gondii
ChEMBL_53335 (CHEMBL664921) Inhibition of Dihydrofolate Reductase of Toxoplasma gondii.
ChEMBL_537410 (CHEMBL992600) Inhibition of polymerase activity of HIV1 RT
ChEMBL_546026 (CHEMBL1034201) Inhibition of Cdc7-mediated phosphorylation of Mcm2
ChEMBL_54972 (CHEMBL666701) Inhibition of Dihydrofolate Reductase of Rat Liver.
ChEMBL_55132 (CHEMBL668777) Inhibition of Dihydrofolate reductase of rat liver
ChEMBL_582224 (CHEMBL1059884) Inhibition of diphenolase activity of mushroom tyrosinase
ChEMBL_589608 (CHEMBL1052161) Inhibition of ligase activity of human MDM2
ChEMBL_644134 (CHEMBL1212033) Inhibition of GTPase activity of Dynamin 1
ChEMBL_646200 (CHEMBL1216341) Inhibition of calcineurin phosphatase activity of CyPA
ChEMBL_673771 (CHEMBL1274948) Inhibition of CYP3A4 in presence of NADPH
ChEMBL_835444 (CHEMBL2072150) Inhibition of core catalytic domain of PDE3A
ChEMBL_835445 (CHEMBL2072151) Inhibition of core catalytic domain of PDE4B
ChEMBL_140005 (CHEMBL748724) Inhibition of binding of [3H]L-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of neostriatum region of forebrain
ChEMBL_140007 (CHEMBL872731) Inhibition of binding of [3H]l-quinuclidinyl benzilate ([3H]L-QNB) to muscarinic acetylcholine receptor of periaqueductal region of midbrain
ChEMBL_140018 (CHEMBL748651) Inhibition of binding of [3H]L-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of subiculum region of forebrain
ChEMBL_2127676 (CHEMBL4837021) Inhibition of eIF4A (unknown origin) assessed as inhibition of translation of RNA featuring highly structured 5'-UTR of c-Myc
Biological Activity Assay The DLK dissociation constants (Kd) have been determined in the KINOMEscan KdELECT Service at DiscoveRx. A fusion protein of full length of human DLK (amino acids 1-859) and the DNA binding domain of NFkB was expressed in transiently transfected HEK293 cells. From these HEK 293 cells, extracts were prepared in M-PER extraction buffer (Pierce) in the presence of Protease Inhibitor Cocktail Complete (Roche) and Phosphatase Inhibitor Cocktail Set II (Merck) per manufacturers' instructions. The DLK fusion protein was labeled with a chimeric double-stranded DNA tag containing the NFkB binding site (5′-GGGAATTCCC-3′) fused to an amplicon for qPCR readout, which was added directly to the expression extract (the final concentration of DNA-tag in the binding reaction is 0.1 nM).
ChEBML_212702 In vitro evaluation of inhibition of cleavage of the chromogenic substrate by human enzyme trypsin
ChEBML_70432 Inhibition of rate of incorporation of [3H]FPP into recombinant Ras-CVIM by human farnesyltransferase.
ChEMBL_142630 (CHEMBL746898) Inhibition of binding of [3H]- nisoxatine to Norepinephrine transporter (NET) of rat cerebral cortex.
ChEMBL_1521038 (CHEMBL3624469) Inhibition of EGFR (unknown origin) by HTRF assay in presence of Km of ATP
ChEMBL_1615834 (CHEMBL3857903) Inhibition of serotonin transporter (unknown origin) assessed as suppression of synaptosomal uptake of serotonin
ChEMBL_1615835 (CHEMBL3857904) Inhibition of norepinephrine transporter (unknown origin) assessed as suppression of synaptosomal uptake of norepinephrine
ChEMBL_1615836 (CHEMBL3857905) Inhibition of dopamine transporter (unknown origin) assessed as suppression of synaptosomal uptake of dopamine
ChEMBL_1877683 (CHEMBL4379077) Inhibition of human LIMK2 in presence of 10 uM of ATP by radiometric analysis
ChEMBL_198044 (CHEMBL800741) Inhibition of binding of [3H]- citalopram to Serotonin transporter (SERT) of rat cerebral cortex.
ChEMBL_215035 (CHEMBL820885) Tested for inhibition of vasopressin-stimulated adenylate cyclase of medullary membranes of pig kidney.
ChEMBL_399838 (CHEMBL910317) Inhibition of non-phosphorylated form of rabbit muscle glycogen phosphorylase in presence of phosphate
ChEMBL_492346 (CHEMBL948342) Inhibition of recombinant TK1-mediated phosphorylation of [CH3-3H]deoxythymidine in presence of dithiothreitol
ChEMBL_90893 (CHEMBL701793) Inhibitory concentration of compound against disintegration (reversal of strand transfer)of HIV-1 integrase
ChEMBL_90894 (CHEMBL701794) Inhibitory concentration of compound against disintegration (reversal of strand transfer)of HIV-1 integrase
ChEMBL_953434 (CHEMBL2350788) Inhibition of recombinant human PTP1B assessed as inhibition of hydrolysis of pNPP by spectrophotometry
Inhibition Assay Inhibition of CODH by Diphenyliodomium chloride. Inactivation of the FAD cofactor of CODH was accomplished by covalent modification of the flavin with diphenyliodonium chloride using a modification of the procedure of Chakraborty and Massey.
Ecto-5'-Nucleotidase Inhibition Assay The enzymatic assay of both human and rat ecto-5'-nucleotidase were performed with slight modifications in the previously described method. The stock solution of compounds were prepared with concentration of 10mM in 10% DMSO and their activity were determined by diluting them further in assay buffer (1 mM CaCl2, 2 mM MgCl2 and 10 mM Tris HCl (pH 7.4) to 1mM concentration. The final assay volume 100 μL contained 70 μL of assay buffer (2 mM MgCl2, 1 mM CaCl2 and 10 mM Tris HCl, pH 7.4), 10 μL of compound and 10 μL of human e5'NT (6.94 μg/mL) protein extract or rat e5'NT (7.17 μg/mL). Then the reaction mixture was incubated for 10 min at 37 °C. Afterwards, 10 μL of AMP substrate was added to initiate the reaction. The reaction was stopped by providing temperature of 99 °C for 20 min. Aliquots of 50 μL of each reaction mixture was transferred into CE mini vial and hydrodynamically injected into the capillary by using pressure of 0.5 psi for 5s. The electrosmatic separation of substrate and product peaks occurred by applying voltage of 15 kV. The concentration of product i.e. adenosine was estimated by calculating the area under its absorbance peak at 260 nm.
ChEMBL_139860 (CHEMBL746357) Inhibition of binding of [3H]l-quinuclidinyl benzilate ([3H]L-QNB) to muscarinic acetylcholine receptor of ventral subiculum region of forebrain
ChEMBL_139876 (CHEMBL744317) Inhibition of binding of [3H]l-quinuclidinyl benzilate ([3H]L-QNB) to muscarinic acetylcholine receptor of cudate nucleus region of forebrain
ChEMBL_139991 (CHEMBL747171) Inhibition of binding of [3H]l-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of hippocampus CA4 region of forebrain
ChEMBL_139995 (CHEMBL747175) Inhibition of binding of [3H]L-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of inferior coliculus region of hindbrain
ChEMBL_140008 (CHEMBL748726) Inhibition of binding of [3H]l-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of pontine nuclei region of hindbrain
ChEMBL_140012 (CHEMBL748645) Inhibition of binding of [3H]L-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of raphe pontis region of hindbrain
ChEMBL_140020 (CHEMBL748653) Inhibition of binding of [3H]L-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of superior coliculus region of midbrain

Query String: prethanol extract of Trifolium pratense