BDBM241950 Neolitsea aciculata extract, 5
BDBM241951 Neolitsea aciculata extract, 6
US9617250, S-entiomer of Example 22 of D1 BDBM317452
BDBM688401 US20240189315, Example P02 of PCT/EP2022/062480) (Prodrug of Ex. 1.10 of PCT/EP2022/062480) US20240342186, P02 (Prodrug of Ex. 1.10)
BDBM688403 US20240189315, Example P03 of PCT/EP2022/062480) (Prodrug of Ex. 1.12 of PCT/EP2022/062480) US20240342186, P03 (Prodrug of Ex. 1.12)
US20240342186, P04 (Prodrug of Ex. 3.14) US20240189315, Example P04 of PCT/EP2022/062480) (Prodrug of Ex. 3.14 of PCT/EP2022/062480) BDBM688405
- Balestrieri, E; Pizzimenti, F; Ferlazzo, A; Giofrè, SV; Iannazzo, D; Piperno, A; Romeo, R; Chiacchio, MA; Mastino, A; Macchi, B Antiviral activity of seed extract from Citrus bergamia towards human retroviruses. Bioorg Med Chem 19: 2084-9 (2011)
- Rempel, V; Fuchs, A; Hinz, S; Karcz, T; Lehr, M; Koetter, U; Müller, CE Magnolia Extract, Magnolol, and Metabolites: Activation of Cannabinoid CB2 Receptors and Blockade of the Related GPR55. ACS Med Chem Lett 4: 41-5 (2013)
- Rainer, B; Revoltella, S; Mayr, F; Moesslacher, J; Scalfari, V; Kohl, R; Waltenberger, B; Pagitz, K; Siewert, B; Schwaiger, S; Stuppner, H From bench to counter: Discovery and validation of a peony extract as tyrosinase inhibiting cosmeceutical. Eur J Med Chem 184: (2019)
- Cuéllar, MJ; Giner, RM; Recio, MC; Just, MJ; Máñez, S; Cerdá, M; Hostettmann, K; Ríos, JL Zanhasaponins A and B, antiphospholipase A2 saponins from an antiinflammatory extract of Zanha africana root bark. J Nat Prod 60: 1158-60 (1998)
- Hüsch, J; Gerbeth, K; Fricker, G; Setzer, C; Zirkel, J; Rebmann, H; Schubert-Zsilavecz, M; Abdel-Tawab, M Effect of phospholipid-based formulations of Boswellia serrata extract on the solubility, permeability, and absorption of the individual boswellic acid constituents present. J Nat Prod 75: 1675-82 (2012)
- Park, MH; Kim, IS; Kim, SA; Na, CS; Hong, CY; Dong, MS; Yoo, HH Inhibitory effect of Rhus verniciflua Stokes extract on human aromatase activity; butin is its major bioactive component. Bioorg Med Chem Lett 24: 1730-3 (2014)
- Wu, T; Jiang, C; Wang, L; Morris-Natschke, SL; Miao, H; Gu, L; Xu, J; Lee, KH; Gu, Q 3,5-Diarylpyrazole Derivatives Obtained by Ammonolysis of the Total Flavonoids from Chrysanthemum indicum Extract Show Potential for the Treatment of Alzheimer's Disease. J Nat Prod 78: 1593-9 (2015)
- Kasangana, PB; Haddad, PS; Eid, HM; Nachar, A; Stevanovic, T Bioactive Pentacyclic Triterpenes from the Root Bark Extract of Myrianthus arboreus, a Species Used Traditionally to Treat Type-2 Diabetes. J Nat Prod 81: 2169-2176 (2018)
- Sharma, R; Gatchie, L; Williams, IS; Jain, SK; Vishwakarma, RA; Chaudhuri, B; Bharate, SB Glycyrrhiza glabra extract and quercetin reverses cisplatin resistance in triple-negative MDA-MB-468 breast cancer cells via inhibition of cytochrome P450 1B1 enzyme. Bioorg Med Chem Lett 27: 5400-5403 (2017)
- Rho, HS; Ahn, SM; Lee, BC; Kim, MK; Ghimeray, AK; Jin, CW; Cho, DH Changes in flavonoid content and tyrosinase inhibitory activity in kenaf leaf extract after far-infrared treatment. Bioorg Med Chem Lett 20: 7534-6 (2010)
- Wangtrakuldee, P; Byrd, MS; Campos, CG; Henderson, MW; Zhang, Z; Clare, M; Masoudi, A; Myler, PJ; Horn, JR; Cotter, PA; Hagen, TJ Discovery of Inhibitors of ACS Med Chem Lett 4: 699-703 (2013)
- Mathavan, I; Liu, LJ; Robinson, SW; El-Sakkary, N; Elatico, AJJ; Gomez, D; Nellas, R; Owens, RJ; Zuercher, W; Navratilova, I; Caffrey, CR; Beis, K Identification of Inhibitors of the ACS Med Chem Lett 13: 1715-1722 (2022)
- Harrison, LA; Atkinson, SJ; Bassil, A; Chung, CW; Grandi, P; Gray, JRJ; Levernier, E; Lewis, A; Lugo, D; Messenger, C; Michon, AM; Mitchell, DJ; Preston, A; Prinjha, RK; Rioja, I; Seal, JT; Taylor, S; Wall, ID; Watson, RJ; Woolven, JM; Demont, EH Identification of a Series of J Med Chem 64: 10742-10771 (2021)
- Bisson, WH; Cheltsov, AV; Bruey-Sedano, N; Lin, B; Chen, J; Goldberger, N; May, LT; Christopoulos, A; Dalton, JT; Sexton, PM; Zhang, XK; Abagyan, R Discovery of antiandrogen activity of nonsteroidal scaffolds of marketed drugs. Proc Natl Acad Sci U S A 104: 11927-32 (2007)
- Manickam, M; Pillaiyar, T; Boggu, P; Venkateswararao, E; Jalani, HB; Kim, ND; Lee, SK; Jeon, JS; Kim, SK; Jung, SH Discovery of enantioselectivity of urea inhibitors of soluble epoxide hydrolase. Eur J Med Chem 117: 113-24 (2016)
- Alnabulsi, S; Hussein, B; Santina, E; Alsalahat, I; Kadirvel, M; Magwaza, RN; Bryce, RA; Schwalbe, CH; Baldwin, AG; Russo, I; Stratford, IJ; Freeman, S Evaluation of analogues of furan-amidines as inhibitors of NQO2. Bioorg Med Chem Lett 28: 1292-1297 (2018)
- Suto, MJ; Gupta, V; Mathew, B; Zhang, W; Pallero, MA; Murphy-Ullrich, JE Identification of Inhibitors of Thrombospondin 1 Activation of TGF-β. ACS Med Chem Lett 11: 1130-1136 (2020)
- Liu, J; Fu, Z; Li, AR; Johnson, M; Zhu, L; Marcus, A; Danao, J; Sullivan, T; Tonn, G; Collins, T; Medina, J Optimization of a series of quinazolinone-derived antagonists of CXCR3. Bioorg Med Chem Lett 19: 5114-8 (2009)
- Madhav, H; Reddy, GS; Rizvi, Z; Jameel, E; Patel, TS; Rahman, A; Yadav, V; Fatima, S; Heyat, F; Pal, K; Minju-Op, A; Subbarao, N; Bhattacharjee, S; Dixit, BC; Sijwali, PS; Hoda, N Reinvestigation of diphenylmethylpiperazine analogues of pyrazine as new class of RSC Med Chem 15: 1022-1037 (2024)
- Bing, DH Nature of the active site of a subunit of the first component of human complement. Biochemistry 8: 4503-10 (1969)
- Bheemanaboina, RRY; de Souza, ML; Gonzalez, ML; Mahmood, SU; Eck, T; Kreiss, T; Aylor, SO; Roth, A; Lee, P; Pybus, BS; Colussi, DJ; Childers, WE; Gordon, J; Siekierka, JJ; Bhanot, P; Rotella, DP Discovery of Imidazole-Based Inhibitors of ACS Med Chem Lett 12: 1962-1967 (2021)
- Pajouhesh, H; Delwig, A; Beckley, JT; Klas, S; Monteleone, D; Zhou, X; Luu, G; Du Bois, J; Hunter, JC; Mulcahy, JV Discovery of Selective Inhibitors of Na ACS Med Chem Lett 13: 1763-1768 (2022)
- Blake, JF; Kallan, NC; Xiao, D; Xu, R; Bencsik, JR; Skelton, NJ; Spencer, KL; Mitchell, IS; Woessner, RD; Gloor, SL; Risom, T; Gross, SD; Martinson, M; Morales, TH; Vigers, GP; Brandhuber, BJ Discovery of pyrrolopyrimidine inhibitors of Akt. Bioorg Med Chem Lett 20: 5607-12 (2010)
- Graef, IA; Alhamadsheh, MM Identification of stabilizers of multimeric proteins US Patent US11337935 (2022)
- Castro, AC; Grogan, MJ; McGovern, KJ; Tremblay, MR Methods of use of cyclopamine analogs US Patent US10314827 (2019)
- Ferreira de Freitas, R; Liu, Y; Szewczyk, MM; Mehta, N; Li, F; McLeod, D; Zepeda-Velázquez, C; Dilworth, D; Hanley, RP; Gibson, E; Brown, PJ; Al-Awar, R; James, LI; Arrowsmith, CH; Barsyte-Lovejoy, D; Min, J; Vedadi, M; Schapira, M; Allali-Hassani, A Discovery of Small-Molecule Antagonists of the PWWP Domain of NSD2. J Med Chem 64: 1584-1592 (2021)
- Ontoria, JM; Paonessa, G; Ponzi, S; Ferrigno, F; Nizi, E; Biancofiore, I; Malancona, S; Graziani, R; Roberts, D; Willis, P; Bresciani, A; Gennari, N; Cecchetti, O; Monteagudo, E; Orsale, MV; Veneziano, M; Di Marco, A; Cellucci, A; Laufer, R; Altamura, S; Summa, V; Harper, S Discovery of a Selective Series of Inhibitors of Plasmodium falciparum HDACs. ACS Med Chem Lett 7: 454-9 (2016)
- Degorce, SL; Anjum, R; Dillman, KS; Drew, L; Groombridge, SD; Halsall, CT; Lenz, EM; Lindsay, NA; Mayo, MF; Pink, JH; Robb, GR; Scott, JS; Stokes, S; Xue, Y Optimization of permeability in a series of pyrrolotriazine inhibitors of IRAK4. Bioorg Med Chem 26: 913-924 (2018)
- Mayhoub, AS; Marler, L; Kondratyuk, TP; Park, EJ; Pezzuto, JM; Cushman, M Optimization of the aromatase inhibitory activities of pyridylthiazole analogues of resveratrol. Bioorg Med Chem 20: 2427-34 (2012)
- Kim, HS; Hammill, JT; Scott, DC; Chen, Y; Rice, AL; Pistel, W; Singh, B; Schulman, BA; Guy, RK Improvement of Oral Bioavailability of Pyrazolo-Pyridone Inhibitors of the Interaction of DCN1/2 and UBE2M. J Med Chem 64: 5850-5862 (2021)
- Bickel, D; Gohlke, H C-terminal modulators of heat shock protein of 90 kDa (HSP90): State of development and modes of action. Bioorg Med Chem 27: (2019)
- Aertgeerts, K; Skene, R; Yano, J; Sang, BC; Zou, H; Snell, G; Jennings, A; Iwamoto, K; Habuka, N; Hirokawa, A; Ishikawa, T; Tanaka, T; Miki, H; Ohta, Y; Sogabe, S Structural analysis of the mechanism of inhibition and allosteric activation of the kinase domain of HER2 protein. J Biol Chem 286: 18756-65 (2011)
- Johnson, M; Li, AR; Liu, J; Fu, Z; Zhu, L; Miao, S; Wang, X; Xu, Q; Huang, A; Marcus, A; Xu, F; Ebsworth, K; Sablan, E; Danao, J; Kumer, J; Dairaghi, D; Lawrence, C; Sullivan, T; Tonn, G; Schall, T; Collins, T; Medina, J Discovery and optimization of a series of quinazolinone-derived antagonists of CXCR3. Bioorg Med Chem Lett 17: 3339-43 (2007)
- Casimiro-Garcia, A; Allais, C; Brennan, A; Choi, C; Dower, G; Farley, KA; Fleming, M; Flick, A; Frisbie, RK; Hall, J; Hepworth, D; Jones, H; Knafels, JD; Kortum, S; Lovering, FE; Mathias, JP; Mohan, S; Morgan, PM; Parng, C; Parris, K; Pullen, N; Schlerman, F; Stansfield, J; Strohbach, JW; Vajdos, FF; Vincent, F; Wang, H; Wang, X; Webster, R; Wright, SW Discovery of a Series of Pyrimidine Carboxamides as Inhibitors of Vanin-1. J Med Chem 65: 757-784 (2022)
- Medina, JR; Grant, SW; Axten, JM; Miller, WH; Donatelli, CA; Hardwicke, MA; Oleykowski, CA; Liao, Q; Plant, R; Xiang, H Discovery of a new series of Aurora inhibitors through truncation of GSK1070916. Bioorg Med Chem Lett 20: 2552-5 (2010)
- Gazzard, L; Appleton, B; Chapman, K; Chen, H; Clark, K; Drobnick, J; Goodacre, S; Halladay, J; Lyssikatos, J; Schmidt, S; Sideris, S; Wiesmann, C; Williams, K; Wu, P; Yen, I; Malek, S Discovery of the 1,7-diazacarbazole class of inhibitors of checkpoint kinase 1. Bioorg Med Chem Lett 24: 5704-9 (2014)
- Occhipinti, A; Berlicki, Ł; Giberti, S; Dziedzioła, G; Kafarski, P; Forlani, G Effectiveness and mode of action of phosphonate inhibitors of plant glutamine synthetase. Pest Manag Sci 66: 51-8 (2010)
- Bauman, DR; Whitehead, A; Contino, LC; Cui, J; Garcia-Calvo, M; Gu, X; Kevin, N; Ma, X; Pai, LY; Shah, K; Shen, X; Stribling, S; Zokian, HJ; Metzger, J; Shevell, DE; Waddell, ST Evaluation of selective inhibitors of 11ß-HSD1 for the treatment of hypertension. Bioorg Med Chem Lett 23: 3650-3 (2013)
- Smith, GF; Altman, MD; Andresen, B; Baker, J; Brubaker, JD; Chen, H; Chen, Y; Childers, M; Donofrio, A; Ferguson, H; Fischer, C; Fischmann, TO; Gibeau, C; Hicks, A; Jin, S; Kattar, S; Kleinschek, MA; Leccese, E; Lesburg, C; Li, C; Lim, J; Liu, D; Maclean, JKF; Mansoor, F; Moy, LY; Mulrooney, EF; Necheva, AS; Presland, J; Rakhilina, L; Yang, R; Torres, L; Zhang-Hoover, J; Northrup, A Identification of quinazoline based inhibitors of IRAK4 for the treatment of inflammation. Bioorg Med Chem Lett 27: 2721-2726 (2017)
- Angelastro, MR; Marquart, AL; Mehdi, S; Koehl, JR; Vaz, RJ; Bey, P; Peet, NP The synthesis of ketomethylene pseudopeptide analogues of dipeptide aldehyde inhibitors of calpain. Bioorg Med Chem Lett 9: 139-40 (1999)
- Kozlov, MV; Konduktorov, KA; Shcherbakova, AS; Kochetkov, SN Synthesis of N'-propylhydrazide analogs of hydroxamic inhibitors of histone deacetylases (HDACs) and evaluation of their impact on activities of HDACs and replication of hepatitis C virus (HCV). Bioorg Med Chem Lett 29: 2369-2374 (2019)
- Petrassi, HM; Lairson, LL; Chin, E; Schultz, PG; Yu, C; Yang, B; Grant, V; Li, Y; Pacheco, A; Chu, A; Johnson, K; Chatterjee, AK AGONISTS OF STIMULATOR OF INTERFERON GENES STING US Patent US20230357253 (2023)
- Foster, AB; Jarman, M; Leung, CS; Rowlands, MG; Taylor, GN; Plevey, RG; Sampson, P Analogues of aminoglutethimide: selective inhibition of aromatase. J Med Chem 28: 200-4 (1985)
- Phommart, S; Sutthivaiyakit, P; Chimnoi, N; Ruchirawat, S; Sutthivaiyakit, S Constituents of the leaves of Macaranga tanarius. J Nat Prod 68: 927-30 (2005)
- Wang, J; Zeng, W; Li, S; Shen, L; Gu, Z; Zhang, Y; Li, J; Chen, S; Jia, X Discovery and Assessment of Atropisomers of (±)-Lesinurad. ACS Med Chem Lett 8: 299-303 (2017)
- Lanman, BA; Allen, JR; Allen, JG; Amegadzie, AK; Ashton, KS; Booker, SK; Chen, JJ; Chen, N; Frohn, MJ; Goodman, G; Kopecky, DJ; Liu, L; Lopez, P; Low, JD; Ma, V; Minatti, AE; Nguyen, TT; Nishimura, N; Pickrell, AJ; Reed, AB; Shin, Y; Siegmund, AC; Tamayo, NA; Tegley, CM; Walton, MC; Wang, HL; Wurz, RP; Xue, M; Yang, KC; Achanta, P; Bartberger, MD; Canon, J; Hollis, LS; McCarter, JD; Mohr, C; Rex, K; Saiki, AY; San Miguel, T; Volak, LP; Wang, KH; Whittington, DA; Zech, SG; Lipford, JR; Cee, VJ Discovery of a Covalent Inhibitor of KRAS J Med Chem 63: 52-65 (2020)
- Gelin, CF; Stenne, B; Coate, H; Hiscox, A; Soyode-Johnson, A; Wall, JL; Lord, B; Schoellerman, J; Coe, KJ; Wang, K; Alcázar, J; Chrovian, CC; Dvorak, CA; Carruthers, NI; Koudriakova, T; Balana, B; Letavic, MA Discovery of a Series of Substituted 1 J Med Chem 66: 2877-2892 (2023)
- Zaware, N; Sharma, H; Yang, J; Devambatla, RK; Queener, SF; Anderson, KS; Gangjee, A Discovery of potent and selective inhibitors of ACS Med Chem Lett 4: 1148-1151 (2013)
- Lanter, JC; Chen, AY; Williamson, T; Koenig, G; Blain, JF; Burnett, DA Discovery of quinuclidine modulators of cellular progranulin. Bioorg Med Chem Lett 47: (2021)
- Rami, HK; Thompson, M; Wyman, P; Jerman, JC; Egerton, J; Brough, S; Stevens, AJ; Randall, AD; Smart, D; Gunthorpe, MJ; Davis, JB Discovery of small molecule antagonists of TRPV1. Bioorg Med Chem Lett 14: 3631-4 (2004)
- Germanas, JP; Wang, S; Miner, A; Hao, W; Ready, JM Discovery of small-molecule inhibitors of tyrosinase. Bioorg Med Chem Lett 17: 6871-5 (2007)
- Niu, Y; Li, Q; Tu, C; Li, N; Gao, L; Lin, H; Wang, Z; Zhou, Z; Li, L Hypouricemic Actions of the Pericarp of Mangosteen J Nat Prod 86: 24-33 (2023)
- Tomala, MD; Magiera-Mularz, K; Kubica, K; Krzanik, S; Zieba, B; Musielak, B; Pustula, M; Popowicz, GM; Sattler, M; Dubin, G; Skalniak, L; Holak, TA Identification of small-molecule inhibitors of USP2a. Eur J Med Chem 150: 261-267 (2018)
- Kelley, JL; Miller, CA; White, HL Inhibition of histidine decarboxylase. Derivatives of histidine. J Med Chem 20: 506-9 (1977)
- Li, L; Wu, T; Feng, J; Ren, P; Liu, Y Inhibitors of ERK and methods of use US Patent US10301317 (2019)
- Posakony, J; Hirao, M; Stevens, S; Simon, JA; Bedalov, A Inhibitors of Sir2: evaluation of splitomicin analogues. J Med Chem 47: 2635-44 (2004)
- Lin, H; He, B Methods of treatment using modulators of SIRT2 US Patent US9359293 (2016)
- Tatsumi, K; Kitahata, S; Komatani, Y; Katsuyama, A; Yakushiji, F; Ichikawa, S Modulation of proteasome subunit selectivity of syringolins. Bioorg Med Chem 106:
- Gajiwala, KS; Huh, CW; Jalaie, M; Patman, RL; Rui, EY; Sun, J; Wythes, MJ Modulators of STING (stimulator of interferon genes) US Patent US11964978 (2024)
- Miah, AH; Smith, IED; Rackham, M; Mares, A; Thawani, AR; Nagilla, R; Haile, PA; Votta, BJ; Gordon, LJ; Watt, G; Denyer, J; Fisher, DT; Dace, P; Giffen, P; Goncalves, A; Churcher, I; Scott-Stevens, P; Harling, JD Optimization of a Series of RIPK2 PROTACs. J Med Chem 64: 12978-13003 (2021)
- Kilburn, JP; Ascic, E; Marigo, M; David, L Prodrugs of modulators of the NMDA receptor US Patent US11358971 (2022)
- Kirby, IT; Person, A; Cohen, M Rational design of selective inhibitors of PARP4. RSC Med Chem 12: 1950-1957 (2021)
- Desjardins, M; Desgagnes, J; Lacoste, L; Yang, F; Morin, M; Lapointe, J; Chenevert, R Synthesis of inhibitors of glutamyl-tRNA synthetase Bioorg Med Chem Lett 7: 2363-2366 (1997)
- Dancer, JE; Ford, MJ; Hamilton, K; Kilkelly, M; Lindell, SD; O'Mahony, MJ; Saville-Stones, EA Synthesis of potent inhibitors of histidinol dehydrogenase Bioorg Med Chem Lett 6: 2131-2136 (1996)
- Barton, DH; Géro, SD; Lawrence, F; Robert-Gero, M; Quiclet-Sire, B; Samadi, M Total synthesis of uracil analogues of sinefungin. J Med Chem 35: 63-7 (1992)
- Ozawa, M; Morita, M; Hirai, G; Tamura, S; Kawai, M; Tsuchiya, A; Oonuma, K; Maruoka, K; Sodeoka, M Contribution of Cage-Shaped Structure of Physalins to Their Mode of Action in Inhibition of NF-kB Activation ACS Med Chem Lett 4: 730-5 (2013)
- Cardozo, MG; Iimura, Y; Sugimoto, H; Yamanishi, Y; Hopfinger, AJ QSAR analyses of the substituted indanone and benzylpiperidine rings of a series of indanone-benzylpiperidine inhibitors of acetylcholinesterase. J Med Chem 35: 584-9 (1992)
- Rich, DH; Sun, ET; Ulm, E Synthesis of analogues of the carboxyl protease inhibitor pepstatin. Effects of structure on inhibition of pepsin and renin. J Med Chem 23: 27-33 (1980)
- Cale, JM; Li, SH; Warnock, M; Su, EJ; North, PR; Sanders, KL; Puscau, MM; Emal, CD; Lawrence, DA Characterization of a novel class of polyphenolic inhibitors of plasminogen activator inhibitor-1. J Biol Chem 285: 7892-902 (2010)
- Sedrani, R; Jones, LH; Jutzi-Eme, AM; Schuler, W; Cottens, S Cleavage of the cyclohexyl-subunit of rapamycin results in loss of immunosuppressive activity. Bioorg Med Chem Lett 9: 459-62 (1999)
- Blass, BE Covalent Inhibitors of the TEC Family of Kinases and Their Methods of Use. ACS Med Chem Lett 9: 587-589 (2018)
- Ujjinamatada, RK; Bhan, A; Hosmane, RS Design of inhibitors against guanase: synthesis and biochemical evaluation of analogues of azepinomycin. Bioorg Med Chem Lett 16: 5551-4 (2006)
- Berlicki, L; Obojska, A; Forlani, G; Kafarski, P Design, synthesis, and activity of analogues of phosphinothricin as inhibitors of glutamine synthetase. J Med Chem 48: 6340-9 (2005)
- Di Chio, C; Previti, S; Amendola, G; Ravichandran, R; Wagner, A; Cosconati, S; Hellmich, UA; Schirmeister, T; Zappalà, M; Ettari, R Development of novel dipeptide nitriles as inhibitors of rhodesain of Trypanosoma brucei rhodesiense. Eur J Med Chem 236: (2022)
- Zhang, Y; Seigal, BA; Terrett, NK; Talbott, RL; Fargnoli, J; Naglich, JG; Chaudhry, C; Posy, SL; Vuppugalla, R; Cornelius, G; Lei, M; Wang, C; Zhang, Y; Schmidt, RJ; Wei, DD; Miller, MM; Allen, MP; Li, L; Carter, PH; Vite, GD; Borzilleri, RM Dimeric Macrocyclic Antagonists of Inhibitor of Apoptosis Proteins for the Treatment of Cancer. ACS Med Chem Lett 6: 770-5 (2015)
- Chowdhury, S; Chafeev, M; Liu, S; Sun, J; Raina, V; Chui, R; Young, W; Kwan, R; Fu, J; Cadieux, JA Discovery of XEN907, a spirooxindole blocker of NaV1.7 for the treatment of pain. Bioorg Med Chem Lett 21: 3676-81 (2011)
- Siu, T; Altman, MD; Baltus, GA; Childers, M; Ellis, JM; Gunaydin, H; Hatch, H; Ho, T; Jewell, J; Lacey, BM; Lesburg, CA; Pan, BS; Sauvagnat, B; Schroeder, GK; Xu, S Discovery of a Novel cGAMP Competitive Ligand of the Inactive Form of STING. ACS Med Chem Lett 10: 92-97 (2019)
- Porter, J; Lumb, S; Lecomte, F; Reuberson, J; Foley, A; Calmiano, M; le Riche, K; Edwards, H; Delgado, J; Franklin, RJ; Gascon-Simorte, JM; Maloney, A; Meier, C; Batchelor, M Discovery of a novel series of quinoxalines as inhibitors of c-Met kinase. Bioorg Med Chem Lett 19: 397-400 (2008)
- Ettari, R; Previti, S; Di Chio, C; Maiorana, S; Allegra, A; Schirmeister, T; Zappalà, M Drug Synergism: Studies of Combination of RK-52 and Curcumin against Rhodesain of ACS Med Chem Lett 11: 806-810 (2020)
- Kawatkar, SP; Barlaam, B; Kemmitt, P; Simpson, I; Watson, D; Wang, P; Lamont, S; Su, Q; Boiko, S; Ikeda, T; Patel, J; Pike, A; Pollard, H; Read, J; Sarkar, U; Wang, H; Wen, Q; Yan, Z; Dowling, JE; Dry, H; Edmondson, SD Identification of a novel series of azabenzimidazole-derived inhibitors of spleen tyrosine kinase. Bioorg Med Chem Lett 30: (2020)
- Hintermann, S; Chiesi, M; von Krosigk, U; Mathé, D; Felber, R; Hengerer, B Identification of a series of highly potent activators of the Nurr1 signaling pathway. Bioorg Med Chem Lett 17: 193-6 (2006)
- Szardenings, AK; Antonenko, V; Campbell, DA; DeFrancisco, N; Ida, S; Shi, L; Sharkov, N; Tien, D; Wang, Y; Navre, M Identification of highly selective inhibitors of collagenase-1 from combinatorial libraries of diketopiperazines. J Med Chem 42: 1348-57 (1999)
- Ouvry, G; Clary, L; Tomas, L; Aurelly, M; Bonnary, L; Borde, E; Bouix-Peter, C; Chantalat, L; Defoin-Platel, C; Deret, S; Forissier, M; Harris, CS; Isabet, T; Lamy, L; Luzy, AP; Pascau, J; Soulet, C; Taddei, A; Taquet, N; Thoreau, E; Varvier, E; Vial, E; Hennequin, LF Impact of Minor Structural Modifications on Properties of a Series of mTOR Inhibitors. ACS Med Chem Lett 10: 1561-1567 (2019)
- Chikhale, RV; Barmade, MA; Murumkar, PR; Yadav, MR Overview of the Development of DprE1 Inhibitors for Combating the Menace of Tuberculosis. J Med Chem 61: 8563-8593 (2018)
- Boivin, RP; Luu-The, V; Lachance, R; Labrie, F; Poirier, D Structure-activity relationships of 17alpha-derivatives of estradiol as inhibitors of steroid sulfatase. J Med Chem 43: 4465-78 (2000)
- Baldwin, RM; Fu, X; Kula, NS; Baldessarini, RJ; Amici, L; Innis, RB; Tamagnan, GD Synthesis and affinity of a possible byproduct of electrophilic radiolabeling of [123I]IBZM. Bioorg Med Chem Lett 13: 4015-7 (2003)
- Szkaradek, N; Rapacz, A; Pytka, K; Filipek, B; Siwek, A; Cegła, M; Marona, H Synthesis and preliminary evaluation of pharmacological properties of some piperazine derivatives of xanthone. Bioorg Med Chem 21: 514-22 (2013)
- Boyle, NA; Talesa, V; Giovannini, E; Rosi, G; Norton, SJ Synthesis and study of thiocarbonate derivatives of choline as potential inhibitors of acetylcholinesterase. J Med Chem 40: 3009-13 (1997)
- Scheeff, S; Rivière, S; Ruiz, J; Abdelrahman, A; Schulz-Fincke, AC; Köse, M; Tiburcy, F; Wieczorek, H; Gütschow, M; Müller, CE; Menche, D Synthesis of Novel Potent Archazolids: Pharmacology of an Emerging Class of Anticancer Drugs. J Med Chem 63: 1684-1698 (2020)
- Bänteli, R; Ernst, B Synthesis of sialyl Lewis(x) mimics. Modifications of the 6-position of galactose. Bioorg Med Chem Lett 11: 459-62 (2001)
- Ehlert, FJ; Griffin, MT; Glidden, PF The interaction of the enantiomers of aceclidine with subtypes of the muscarinic receptor. J Pharmacol Exp Ther 279: 1335-44 (1996)
- Millet Aguilar-Galindo, O; Laín Torre, A Use of inhibitors of porphobilinogen deaminase in the treatment of congenital erythropoietic porphyria US Patent US9138423 (2015)
- Gleeson, P; Bravi, G; Modi, S; Lowe, D ADMET rules of thumb II: A comparison of the effects of common substituents on a range of ADMET parameters. Bioorg Med Chem 17: 5906-19 (2009)
- Khan, MT; Khan, R; Wuxiuer, Y; Arfan, M; Ahmed, M; Sylte, I Identification of novel quinazolin-4(3H)-ones as inhibitors of thermolysin, the prototype of the M4 family of proteinases. Bioorg Med Chem 18: 4317-27 (2010)
- Rich, DH; Salituro, FG Synthesis of analogues of pepstatin. Effect of structure in subsites P1', P2', and P2 on inhibition of porcine pepsin. J Med Chem 26: 904-10 (1983)
- Rich, DH; Bernatowicz, MS Synthesis of analogues of the carboxyl protease inhibitor pepstatin. Effect of structure in subsite P3 on inhibition of pepsin. J Med Chem 25: 791-5 (1982)
- Rodriguez, M; Fulcrand, P; Laur, J; Aumelas, A; Bali, JP; Martinez, J Synthesis of gastrin antagonists, analogues of the C-terminal tetrapeptide of gastrin, by introduction of a beta-homo residue. J Med Chem 32: 522-8 (1989)
- León, F; Obeng, S; Mottinelli, M; Chen, Y; King, TI; Berthold, EC; Kamble, SH; Restrepo, LF; Patel, A; Gamez-Jimenez, LR; Lopera-Londoño, C; Hiranita, T; Sharma, A; Hampson, AJ; Canal, CE; McMahon, LR; McCurdy, CR Activity of J Med Chem 64: 13510-13523 (2021)
- Zhao, F; Atxabal, U; Mariottini, S; Yi, F; Lotti, JS; Rouzbeh, N; Liu, N; Bunch, L; Hansen, KB; Clausen, RP Derivatives of ( J Med Chem 65: 734-746 (2022)
- Yamada, A; Kazui, Y; Yoshioka, H; Tanatani, A; Mori, S; Kagechika, H; Fujii, S Development of ACS Med Chem Lett 7: 1028-1033 (2016)
- Garrison, AT; Orsi, DL; Capstick, RA; Whomble, D; Li, J; Carter, TR; Felts, AS; Vinson, PN; Rodriguez, AL; Han, A; Hajari, K; Cho, HP; Teal, LB; Ragland, MG; Ghamari-Langroudi, M; Bubser, M; Chang, S; Schnetz-Boutaud, NC; Boutaud, O; Blobaum, AL; Foster, DJ; Niswender, CM; Conn, PJ; Lindsley, CW; Jones, CK; Han, C Development of J Med Chem 65: 6273-6286 (2022)
- Jia, J; Yi, L; Xia, Z; Yang, M; Qiu, D; Zhao, Z; Peng, Z Development of [ Bioorg Med Chem Lett 88: (2023)
- Chen, Z; Hu, B; Rej, RK; Wu, D; Acharyya, RK; Wang, M; Xu, T; Lu, J; Metwally, H; Wang, Y; McEachern, D; Bai, L; Gersch, CL; Wang, M; Zhang, W; Li, Q; Wen, B; Sun, D; Rae, JM; Wang, S Discovery of J Med Chem 66: 12559-12585 (2023)
- Li, D; Zhang, Z; Li, Y; Wang, X; Zhong, H; Yang, H; Xi, Y; Liu, H; Shen, A; Hu, Y Discovery of ( J Med Chem 66: 7016-7037 (2023)
- Perkins, JJ; McQuade, P; Bungard, CJ; Diamond, TL; Gantert, LT; Gotter, AL; Hanney, B; Hills, ID; Hurzy, DM; Joshi, A; Kern, JT; Schlegel, KS; Manikowski, JJ; Meng, Z; O'Brien, JA; Roecker, AJ; Smith, SM; Uslaner, JM; Hostetler, E; Meissner, RS Discovery of [ ACS Med Chem Lett 14: 986-992 (2023)
- Bubenik, M; Mader, P; Mochirian, P; Vallée, F; Clark, J; Truchon, JF; Perryman, AL; Pau, V; Kurinov, I; Zahn, KE; Leclaire, ME; Papp, R; Mathieu, MC; Hamel, M; Duffy, NM; Godbout, C; Casas-Selves, M; Falgueyret, JP; Baruah, PS; Nicolas, O; Stocco, R; Poirier, H; Martino, G; Fortin, AB; Roulston, A; Chefson, A; Dorich, S; St-Onge, M; Patel, P; Pellerin, C; Ciblat, S; Pinter, T; Barabé, F; El Bakkouri, M; Parikh, P; Gervais, C; Sfeir, A; Mamane, Y; Morris, SJ; Black, WC; Sicheri, F; Gallant, M Identification of J Med Chem 65: 13198-13215 (2022)
- Hu, XL; Lv, XY; Wang, R; Long, H; Feng, JH; Wang, BL; Shen, W; Liu, H; Xiong, F; Zhang, XQ; Ye, WC; Wang, H Optimization of J Med Chem 64: 7760-7777 (2021)
- Kudo, Y; Hanifin, CT; Kotaki, Y; Yotsu-Yamashita, M Structures of J Nat Prod 83: 2706-2717 (2020)
- Yoder, RJ; Zhuang, Q; Beck, JM; Franjesevic, A; Blanton, TG; Sillart, S; Secor, T; Guerra, L; Brown, JD; Reid, C; McElroy, CA; Doğan Ekici, Ö; Callam, CS; Hadad, CM Study of ACS Med Chem Lett 8: 622-627 (2017)
- Cheng, MC; Li, CY; Ko, HC; Ko, FN; Lin, YL; Wu, TS Antidepressant principles of the roots of Polygala tenuifolia. J Nat Prod 69: 1305-9 (2006)
- DeMartino, JK; Hwang, I; Connelly, S; Wilson, IA; Boger, DL Asymmetric synthesis of inhibitors of glycinamide ribonucleotide transformylase. J Med Chem 51: 5441-8 (2008)
- Garcia-Jimenez, A; Teruel-Puche, JA; Berna, J; Rodriguez-Lopez, JN; Tudela, J; Garcia-Ruiz, PA; Garcia-Canovas, F Characterization of the action of tyrosinase on resorcinols. Bioorg Med Chem 24: 4434-4443 (2016)
- Xu, W; Zhu, C; Cheng, W; Fan, X; Chen, X; Yang, S; Guo, Y; Ye, F; Shi, J Chemical Constituents of the Roots of Euphorbia micractina. J Nat Prod 72: 1620-6 (2009)
- Shao, L; Abolin, C; Hewitt, MC; Koch, P; Varney, M Derivatives of tramadol for increased duration of effect. Bioorg Med Chem Lett 16: 691-4 (2005)
- Zhang, X; Xu, F; Tong, L; Zhang, T; Xie, H; Lu, X; Ren, X; Ding, K Design and synthesis of selective degraders of EGFR Eur J Med Chem 192: (2020)
- Cody, WL; Doherty, AM; He, JX; DePue, PL; Rapundalo, ST; Hingorani, GA; Major, TC; Panek, RL; Dudley, DT; Haleen, SJ Design of a functional hexapeptide antagonist of endothelin. J Med Chem 35: 3301-3 (1992)
- Gabriel, B; Stubbs, MT; Bergner, A; Hauptmann, J; Bode, W; Stürzebecher, J; Moroder, L Design of benzamidine-type inhibitors of factor Xa. J Med Chem 41: 4240-50 (1998)
- Freeman-Cook, KD; Autry, C; Borzillo, G; Gordon, D; Barbacci-Tobin, E; Bernardo, V; Briere, D; Clark, T; Corbett, M; Jakubczak, J; Kakar, S; Knauth, E; Lippa, B; Luzzio, MJ; Mansour, M; Martinelli, G; Marx, M; Nelson, K; Pandit, J; Rajamohan, F; Robinson, S; Subramanyam, C; Wei, L; Wythes, M; Morris, J Design of selective, ATP-competitive inhibitors of Akt. J Med Chem 53: 4615-22 (2010)
- Atkinson, SJ; Bagal, SK; Argyrou, A; Askin, S; Cheung, T; Chiarparin, E; Coen, M; Collie, IT; Dale, IL; De Fusco, C; Dillman, K; Evans, L; Feron, LJ; Foster, AJ; Grondine, M; Kantae, V; Lamont, GM; Lamont, S; Lynch, JT; Nilsson Lill, S; Robb, GR; Saeh, J; Schimpl, M; Scott, JS; Smith, J; Srinivasan, B; Tentarelli, S; Vazquez-Chantada, M; Wagner, D; Walsh, JJ; Watson, D; Williamson, B Development of a Series of Pyrrolopyridone MAT2A Inhibitors. J Med Chem 67: 4541-4559
- Roth, AG; Redmer, S; Arenz, C Development of carbohydrate-derived inhibitors of acid sphingomyelinase. Bioorg Med Chem 18: 939-44 (2010)
- Chambers, RJ; Antognoli, GW; Cheng, JB; Marfat, A; Pillar, JS; Shirley, JT; Watson, JW Development of new chromanol antagonists of leukotriene D4. Bioorg Med Chem Lett 8: 1791-6 (1998)
- Ji, W; Wang, ES; Manz, TD; Jiang, J; Donovan, KA; Abulaiti, X; Fischer, ES; Cantley, LC; Zhang, T; Gray, NS Development of potent and selective degraders of PI5P4Kγ. Eur J Med Chem 247: (2023)
- Aldrich, LN; Burdette, JE; Carcache de Blanco, E; Coss, CC; Eustaquio, AS; Fuchs, JR; Kinghorn, AD; MacFarlane, A; Mize, BK; Oberlies, NH; Orjala, J; Pearce, CJ; Phelps, MA; Rakotondraibe, LH; Ren, Y; Soejarto, DD; Stockwell, BR; Yalowich, JC; Zhang, X Discovery of Anticancer Agents of Diverse Natural Origin. J Nat Prod 85: 702-719 (2022)
- Tanaka, Y; Kurasawa, O; Yokota, A; Klein, MG; Ono, K; Saito, B; Matsumoto, S; Okaniwa, M; Ambrus-Aikelin, G; Morishita, D; Kitazawa, S; Uchiyama, N; Ogawa, K; Kimura, H; Imamura, S Discovery of Novel Allosteric Inhibitors of Deoxyhypusine Synthase. J Med Chem 63: 3215-3226 (2020)
- Shinozuka, T; Ito, S; Kimura, T; Izumi, M; Wakabayashi, K Discovery of a Novel Class of ERRα Agonists. ACS Med Chem Lett 12: 817-821 (2021)
- Ferguson, FM; Ni, J; Zhang, T; Tesar, B; Sim, T; Kim, ND; Deng, X; Brown, JR; Zhao, JJ; Gray, NS Discovery of a Series of 5,11-Dihydro-6 ACS Med Chem Lett 7: 908-912 (2016)
- Wang, YH; Zhou, MZ; Ye, T; Wang, PP; Lu, R; Wang, YL; Liu, CX; Xiao, W; Li, JY; Meng, ZB; Xu, LL; Hu, QH; Jiang, C Discovery of a Series of 5-Amide-1 J Med Chem 65: 15967-15990 (2022)
- Pryde, DC; Marron, BE; West, CW; Reister, S; Amato, G; Yoger, K; Antonio, B; Padilla, K; Cox, PJ; Turner, J; Warmus, JS; Swain, NA; Omoto, K; Mahoney, JH; Gerlach, AC Discovery of a Series of Indazole TRPA1 Antagonists. ACS Med Chem Lett 8: 666-671 (2017)
- Crosignani, S; Missotten, M; Cleva, C; Dondi, R; Ratinaud, Y; Humbert, Y; Mandal, AB; Bombrun, A; Power, C; Chollet, A; Proudfoot, A Discovery of a novel series of CXCR3 antagonists. Bioorg Med Chem Lett 20: 3614-7 (2010)
- Hu, Y; Cole, D; Denny, RA; Anderson, DR; Ipek, M; Ni, Y; Wang, X; Thaisrivongs, S; Chamberlain, T; Hall, JP; Liu, J; Luong, M; Lin, LL; Telliez, JB; Gopalsamy, A Discovery of indazoles as inhibitors of Tpl2 kinase. Bioorg Med Chem Lett 21: 4758-61 (2011)
- Biswas, T; Green, KD; Garneau-Tsodikova, S; Tsodikov, OV Discovery of inhibitors of Bacillus anthracis primase DnaG. Biochemistry 52: 6905-10 (2013)
- Peng, X; Lanter, JC; Y-P Chen, A; Brand, MA; Wozniak, MK; Hoekman, S; Longin, O; Regeling, H; Zonneveld, W; P L Bell, R; Koenig, G; Hurst, RS; Blain, JF; Burnett, DA Discovery of oxazoline enhancers of cellular progranulin release. Bioorg Med Chem Lett 80: (2023)
- Shah, P; Cheasty, A; Foxton, C; Raynham, T; Farooq, M; Gutierrez, IF; Lejeune, A; Pritchard, M; Turnbull, A; Pang, L; Owen, P; Boyd, S; Stowell, A; Jordan, A; Hamilton, NM; Hitchin, JR; Stockley, M; MacDonald, E; Quesada, MJ; Trivier, E; Skeete, J; Ovaa, H; Moolenaar, WH; Ryder, H Discovery of potent inhibitors of the lysophospholipase autotaxin. Bioorg Med Chem Lett 26: 5403-5410 (2016)
- Butler, JR; Rescourio, G; Milgram, BC; Foti, RS; Kornecook, T; Ligutti, J; Moyer, BD; Taborn, K; Youngblood, BD; Yu, V; Shimanovich, R; Boezio, A; Weiss, M Discovery of pyridyl urea sulfonamide inhibitors of Na Bioorg Med Chem Lett 73: (2022)
- Emmitte, KA; Andrews, CW; Badiang, JG; Davis-Ward, RG; Dickson, HD; Drewry, DH; Emerson, HK; Epperly, AH; Hassler, DF; Knick, VB; Kuntz, KW; Lansing, TJ; Linn, JA; Mook, RA; Nailor, KE; Salovich, JM; Spehar, GM; Cheung, M Discovery of thiophene inhibitors of polo-like kinase. Bioorg Med Chem Lett 19: 1018-21 (2009)
- Walters, I; Austin, C; Austin, R; Bonnert, R; Cage, P; Christie, M; Ebden, M; Gardiner, S; Grahames, C; Hill, S; Hunt, F; Jewell, R; Lewis, S; Martin, I; David Nicholls, na; David Robinson, na Evaluation of a series of bicyclic CXCR2 antagonists. Bioorg Med Chem Lett 18: 798-803 (2008)
- Harner, MJ; Chauder, BA; Phan, J; Fesik, SW Fragment-based screening of the bromodomain of ATAD2. J Med Chem 57: 9687-92 (2014)
- Sampson, D; Bricker, B; Zhu, XY; Peprah, K; Lamango, NS; Setola, V; Roth, BL; Ablordeppey, SY Further evaluation of the tropane analogs of haloperidol. Bioorg Med Chem Lett 24: 4294-7 (2014)
- ELZEIN, E HETEROCYCLIC INHIBITORS OF CD73 FOR TREATMENT OF DISEASE US Patent US20240140980 (2024)
- De Savi, C; Waterson, D; Pape, A; Lamont, S; Hadley, E; Mills, M; Page, KM; Bowyer, J; Maciewicz, RA Hydantoin based inhibitors of MMP13--discovery of AZD6605. Bioorg Med Chem Lett 23: 4705-12 (2013)
- Jarman, M; Barrie, SE; Deadman, JJ; Houghton, J; McCague, R; Rowlands, MG Hydroxyperfluoroazobenzenes: novel inhibitors of enzymes of androgen biosynthesis. J Med Chem 33: 2452-5 (1990)
- CAO, J; COME, JH; DAKIN, LA; DENIS, F; DORSCH, WA; FORTIER, A; HAMEL, M; KRUEGER, EB; LEDFORD, B; NANTHAKUMAR, SS; NICOLAS, O; SAYEGH, C; SENTER, TJ; WANG, T; BRODNEY, M; HU, K; ROSE, P; GAGNON, K; SHI, Y; SHRESTHA, M; MEDEK, A; WITKOS, F INHIBITORS OF APOL1 AND METHODS OF USING SAME US Patent US20230271945 (2023)
- Haftchenary, S; Jouk, AO; Aubry, I; Lewis, AM; Landry, M; Ball, DP; Shouksmith, AE; Collins, CV; Tremblay, ML; Gunning, PT Identification of Bidentate Salicylic Acid Inhibitors of PTP1B. ACS Med Chem Lett 6: 982-6 (2015)
- Riboldi, GP; Zigweid, R; Myler, PJ; Mayclin, SJ; Couñago, RM; Staker, BL Identification of P218 as a potent inhibitor of RSC Med Chem 12: 103-109 (2021)
- Peace, S; Philp, J; Brooks, C; Piercy, V; Moores, K; Smethurst, C; Watson, S; Gaines, S; Zippoli, M; Mookherjee, C; Ife, R Identification of a sulfonamide series of CCR2 antagonists. Bioorg Med Chem Lett 20: 3961-4 (2010)
- Brown, A; Ellis, D; Wallace, O; Ralph, M Identification of amide bioisosteres of triazole oxytocin antagonists. Bioorg Med Chem Lett 20: 2224-8 (2010)
- Patouret, R; Doebelin, C; Garcia-Ordonez, RD; Chang, MR; Ruiz, C; Cameron, MD; Griffin, PR; Kamenecka, TM Identification of an aminothiazole series of RORβ modulators. Bioorg Med Chem Lett 28: 1178-1181 (2018)
- Xie, YF; Sircar, I; Lake, K; Komandla, M; Ligsay, K; Li, J; Xu, K; Parise, J; Schneider, L; Huang, D; Liu, J; Sakurai, N; Barbosa, M; Jack, R Identification of novel series of human CCR1 antagonists. Bioorg Med Chem Lett 18: 2215-21 (2008)
- Pitts, WJ; Vaccaro, W; Huynh, T; Leftheris, K; Roberge, JY; Barbosa, J; Guo, J; Brown, B; Watson, A; Donaldson, K; Starling, GC; Kiener, PA; Poss, MA; Dodd, JH; Barrish, JC Identification of purine inhibitors of phosphodiesterase 7 (PDE7). Bioorg Med Chem Lett 14: 2955-8 (2004)
- Mahasenan, KV; Ding, D; Gao, M; Nguyen, TT; Suckow, MA; Schroeder, VA; Wolter, WR; Chang, M; Mobashery, S In Search of Selectivity in Inhibition of ADAM10. ACS Med Chem Lett 9: 708-713 (2018)
- Abdel-Magid, AF Inhibitors of ATR Kinase for Treatment of Cancer. ACS Med Chem Lett 4: 688-9 (2013)
- Gray, NS; De Clercq, D; Jang, J; Janne, P; To, C; Eck, M; Park, E; Heppner, D Inhibitors of EGFR and methods of use thereof US Patent US11584746 (2023)
- Lazo, JS; Sharlow, ER; McQueeney, KE; Wipf, P; Salamoun, JM Inhibitors of PTP4A3 for the treatment of cancer US Patent US10308663 (2019)
- Han, H; Yoon, J; Janda, KD Investigations of azapeptides as mimetics of Leu-enkephalin. Bioorg Med Chem Lett 8: 117-20 (1999)
- Davis, DC; Bungard, JD; Chang, S; Rodriguez, AL; Blobaum, AL; Boutaud, O; Melancon, BJ; Niswender, CM; Jeffrey Conn, P; Lindsley, CW Lead optimization of the VU0486321 series of mGlu Bioorg Med Chem Lett 32: (2021)
- Borzilleri, RM; Zhang, Y; Miller, M; Fraley, A Macrocyclic compounds for inhibition of inhibitors of apoptosis US Patent US9605022 (2017)
- Ryu, K; Kim, M; Griesinger, C; Lee, D Method of increasing platelet counts of a subject US Patent US11744839 (2023)
- Hammock, BD; Hwang, SH; Hashimoto, K; Ren, Q Methods of inhibiting formation of alpha synuclein aggregates US Patent US12251379 (2025)
- Vacca, J Modulators of HSD17B13 and methods of use thereof US Patent US11957687 (2024)
- Kumaravel, G; Boettcher, BR; Shapiro, MJ; Petter, C Peptide mimics of glycylproline as inhibitors of prolidase Bioorg Med Chem Lett 5: 2825-2828 (1995)
- Lee, MJ; Nagasawa, HT; Elberling, JA; DeMaster, EG Prodrugs of nitroxyl as inhibitors of aldehyde dehydrogenase. J Med Chem 35: 3648-52 (1992)
- Morgan, RK; Kirby, IT; Vermehren-Schmaedick, A; Rodriguez, K; Cohen, MS Rational Design of Cell-Active Inhibitors of PARP10. ACS Med Chem Lett 10: 74-79 (2019)
- Riefolo, F; Sortino, R; Matera, C; Claro, E; Preda, B; Vitiello, S; Traserra, S; Jiménez, M; Gorostiza, P Rational Design of Photochromic Analogues of Tricyclic Drugs. J Med Chem 64: 9259-9270 (2021)
- Narwal, M; Venkannagari, H; Lehtiö, L Structural basis of selective inhibition of human tankyrases. J Med Chem 55: 1360-7 (2012)
- Kalbfleisch, JJ; Reed, CW; Park, C; Spearing, PK; Quitalig, MC; Jenkins, MT; Rodriguez, AL; Blobaum, AL; Conn, PJ; Niswender, CM; Lindsley, CW Synthesis and SAR of a series of mGlu Bioorg Med Chem Lett 30: (2020)
- Igarashi, Y; Ichikawa, M; Ichikawa, Y Synthesis of a new inhibitor of α-fucosidase Bioorg Med Chem Lett 6: 553-558 (1996)
- Lee, S; Jung, KY; Park, J; Cho, JH; Kim, YC; Chang, S Synthesis of potent chemical inhibitors of dynamin GTPase. Bioorg Med Chem Lett 20: 4858-64 (2010)
- Tinto, F; Villano, R; Kostrzewa, M; Ligresti, A; Straker, H; Manzo, E Synthesis of the Major Mammalian Metabolites of THCV. J Nat Prod 83: 2060-2065 (2020)
- Bhat, L; Bhat, SR Synthesis, methods of using, and compositions of cycloalkylmethylamines US Patent US9302981 (2016)
- La, DS; Peterson, EA; Bode, C; Boezio, AA; Bregman, H; Chu-Moyer, MY; Coats, J; DiMauro, EF; Dineen, TA; Du, B; Gao, H; Graceffa, R; Gunaydin, H; Guzman-Perez, A; Fremeau, R; Huang, X; Ilch, C; Kornecook, TJ; Kreiman, C; Ligutti, J; Jasmine Lin, MH; McDermott, JS; Marx, I; Matson, DJ; McDonough, SI; Moyer, BD; Nho Nguyen, H; Taborn, K; Yu, V; Weiss, MM The discovery of benzoxazine sulfonamide inhibitors of Na Bioorg Med Chem Lett 27: 3477-3485 (2017)
- Anthony Romero, F; Hastings, NB; Moningka, R; Guo, Z; Wang, M; Di Salvo, J; Lei, Y; Trusca, D; Deng, Q; Tong, V; Terebetski, JL; Ball, RG; Ujjainwalla, F The discovery of potent antagonists of NPBWR1 (GPR7). Bioorg Med Chem Lett 22: 1014-8 (2012)
- Chiosis, G; Greengard, P; Dou, F; Luo, W; He, H; Zatorska, D Treatment of neurodegenerative diseases through inhibition of HSP90 US Patent US10336757 (2019)
- Unzue, A; Jessen-Trefzer, C; Spiliotopoulos, D; Gaudio, E; Tarantelli, C; Dong, J; Zhao, H; Pachmayr, J; Zahler, S; Bernasconi, E; Sartori, G; Cascione, L; Bertoni, F; Śledź, P; Caflisch, A; Nevado, C Understanding the mechanism of action of pyrrolo[3,2- RSC Med Chem 11: 665-675 (2020)
- Cioffi, G; D'Auria, M; Braca, A; Mendez, J; Castillo, A; Morelli, I; De Simone, F; De Tommasi, N Antioxidant and free-radical scavenging activity of constituents of the leaves of Tachigalia paniculata. J Nat Prod 65: 1526-9 (2002)
- Pauli-Magnus, C; von Richter, O; Burk, O; Ziegler, A; Mettang, T; Eichelbaum, M; Fromm, MF Characterization of the major metabolites of verapamil as substrates and inhibitors of P-glycoprotein. J Pharmacol Exp Ther 293: 376-82 (2000)
- Queiroz, MM; Queiroz, EF; Zeraik, ML; Ebrahimi, SN; Marcourt, L; Cuendet, M; Castro-Gamboa, I; Hamburger, M; da Silva Bolzani, V; Wolfender, JL Chemical composition of the bark of Tetrapterys mucronata and identification of acetylcholinesterase inhibitory constituents. J Nat Prod 77: 650-6 (2014)
- Rogers, JL; Bayeh, L; Scheuermann, TH; Longgood, J; Key, J; Naidoo, J; Melito, L; Shokri, C; Frantz, DE; Bruick, RK; Gardner, KH; MacMillan, JB; Tambar, UK Development of inhibitors of the PAS-B domain of the HIF-2a transcription factor. J Med Chem 56: 1739-47 (2013)
- Concha, N; Huang, J; Bai, X; Benowitz, A; Brady, P; Grady, LC; Kryn, LH; Holmes, D; Ingraham, K; Jin, Q; Pothier Kaushansky, L; McCloskey, L; Messer, JA; O'Keefe, H; Patel, A; Satz, AL; Sinnamon, RH; Schneck, J; Skinner, SR; Summerfield, J; Taylor, A; Taylor, JD; Evindar, G; Stavenger, RA Discovery and Characterization of a Class of Pyrazole Inhibitors of Bacterial Undecaprenyl Pyrophosphate Synthase. J Med Chem 59: 7299-304 (2016)
- Lu, T; Connolly, PJ; Philippar, U; Sun, W; Cummings, MD; Barbay, K; Gys, L; Van Nuffel, L; Austin, N; Bekkers, M; Shen, F; Cai, A; Attar, R; Meerpoel, L; Edwards, J Discovery and optimization of a series of small-molecule allosteric inhibitors of MALT1 protease. Bioorg Med Chem Lett 29: (2019)
- Crosignani, S; Jorand-Lebrun, C; Campbell, G; Prêtre, A; Grippi-Vallotton, T; Quattropani, A; Bouscary-Desforges, G; Bombrun, A; Missotten, M; Humbert, Y; Frémaux, C; Pâquet, M; El Harkani, K; Bradshaw, CG; Cleva, C; Abla, N; Daff, H; Schott, O; Pittet, PA; Arrighi, JF; Gaudet, M; Johnson, Z Discovery of a Novel Series of CRTH2 (DP2) Receptor Antagonists Devoid of Carboxylic Acids. ACS Med Chem Lett 2: 938-942 (2011)
- Oyama, T; Takahashi, S; Yoshimori, A; Yamamoto, T; Sato, A; Kamiya, T; Abe, H; Abe, T; Tanuma, SI Discovery of a new type of scaffold for the creation of novel tyrosinase inhibitors. Bioorg Med Chem 24: 4509-4515 (2016)
- Nowak, P; Cole, DC; Brooijmans, N; Bursavich, MG; Curran, KJ; Ellingboe, JW; Gibbons, JJ; Hollander, I; Hu, Y; Kaplan, J; Malwitz, DJ; Toral-Barza, L; Verheijen, JC; Zask, A; Zhang, WG; Yu, K Discovery of potent and selective inhibitors of the mammalian target of rapamycin (mTOR) kinase. J Med Chem 52: 7081-9 (2009)
- Oost, TK; Sun, C; Armstrong, RC; Al-Assaad, AS; Betz, SF; Deckwerth, TL; Ding, H; Elmore, SW; Meadows, RP; Olejniczak, ET; Oleksijew, A; Oltersdorf, T; Rosenberg, SH; Shoemaker, AR; Tomaselli, KJ; Zou, H; Fesik, SW Discovery of potent antagonists of the antiapoptotic protein XIAP for the treatment of cancer. J Med Chem 47: 4417-26 (2004)
- Weglarz-Tomczak, E; Tomczak, JM; Giurg, M; Burda-Grabowska, M; Brul, S Discovery of potent inhibitors of PLproCoV2 by screening a library of selenium-containing compounds bioRxiv 1-12 (2020)
- Faucher, AM; White, PW; Brochu, C; Grand-Maître, C; Rancourt, J; Fazal, G Discovery of small-molecule inhibitors of the ATPase activity of human papillomavirus E1 helicase. J Med Chem 47: 18-21 (2003)
- PubChem, PC Dose response confirmation of the uHTS fluorescent assay for identification of inhibitors of ATG4B. PubChem Bioassay (2011)
- Jackson, CM; Blass, B; Coburn, K; Djandjighian, L; Fadayel, G; Fluxe, AJ; Hodson, SJ; Janusz, JM; Murawsky, M; Ridgeway, JM; White, RE; Wu, S Evolution of thiazolidine-based blockers of human Kv1.5 for the treatment of atrial arrhythmias. Bioorg Med Chem Lett 17: 282-4 (2006)
- Palmer, N; Agnew, C; Benn, C; Buffham, WJ; Castro, JN; Chessari, G; Clark, M; Cons, BD; Coyle, JE; Dawson, LA; Hamlett, CCF; Hodson, C; Holding, F; Johnson, CN; Liebeschuetz, JW; Mahajan, P; McCarthy, JM; Murray, CW; O'Reilly, M; Peakman, T; Price, A; Rapti, M; Reeks, J; Schöpf, P; St-Denis, JD; Valenzano, C; Wallis, NG; Walser, R; Weir, H; Wilsher, NE; Woodhead, A; Bento, CF; Tisi, D Fragment-Based Discovery of a Series of Allosteric-Binding Site Modulators of β-Glucocerebrosidase. J Med Chem 67: 11168-11181
- Kundu, B; Bauser, M; Betschinger, J; Kraas, W; Jung, G Identification of a potent analogue of Nazumamide A through iteration of combinatorial tetrapeptide libraries. Bioorg Med Chem Lett 8: 1669-72 (1999)
- Dios, A; Mitchell, RA; Aljabari, B; Lubetsky, J; O'Connor, K; Liao, H; Senter, PD; Manogue, KR; Lolis, E; Metz, C; Bucala, R; Callaway, DJ; Al-Abed, Y Inhibition of MIF bioactivity by rational design of pharmacological inhibitors of MIF tautomerase activity. J Med Chem 45: 2410-6 (2002)
- McCague, R; Rowlands, MG; Barrie, SE; Houghton, J Inhibition of enzymes of estrogen and androgen biosynthesis by esters of 4-pyridylacetic acid. J Med Chem 33: 3050-5 (1990)
- Alvarado, M; Decara, J; Luque, MJ; Hernandez-Folgado, L; Gómez-Cañas, M; Gómez-Ruiz, M; Fernández-Ruiz, J; Elguero, J; Jagerovic, N; Serrano, A; Goya, P; de Fonseca, FR Novel antiobesity agents: synthesis and pharmacological evaluation of analogues of Rimonabant and of LH21. Bioorg Med Chem 21: 1708-16 (2013)
- Skerlj, RT; Bastos, CM; Booker, ML; Kramer, ML; Barker, RH; Celatka, CA; Munoz, B; Sidhu, AB; Cortese, JF; Wittlin, S; Papastogiannidis, P; Angulo-Barturen, I; Jimenez-Diaz, MB; Sybertz, E Optimization of Potent Inhibitors of P. falciparum Dihydroorotate Dehydrogenase for the Treatment of Malaria. ACS Med Chem Lett 2: 708-713 (2011)
- Garfunkle, J; Ezzili, C; Rayl, TJ; Hochstatter, DG; Hwang, I; Boger, DL Optimization of the central heterocycle of alpha-ketoheterocycle inhibitors of fatty acid amide hydrolase. J Med Chem 51: 4392-403 (2008)
- Jacobson, AE; Rice, KC; Reden, J; Lupinacci, L; Brossi, A; Streaty, RA; Klee, WA Paradoxical effects of N-cyanoalkyl substituents upon the activities of several classes of opioids. J Med Chem 22: 328-31 (1979)
- Madden, BA; Prestwich, GD Potency and inactivation rates of analogues of an irreversible inhibitor of vertebrate oxidosqualene cyclase Bioorg Med Chem Lett 7: 309-314 (1997)
- Beltramo, M; Robert, V; Galibert, M; Madinier, JB; Marceau, P; Dardente, H; Decourt, C; De Roux, N; Lomet, D; Delmas, AF; Caraty, A; Aucagne, V Rational design of triazololipopeptides analogs of kisspeptin inducing a long-lasting increase of gonadotropins. J Med Chem 58: 3459-70 (2015)
- Hegemann, JD; De Simone, M; Zimmermann, M; Knappe, TA; Xie, X; Di Leva, FS; Marinelli, L; Novellino, E; Zahler, S; Kessler, H; Marahiel, MA Rational improvement of the affinity and selectivity of integrin binding of grafted lasso peptides. J Med Chem 57: 5829-34 (2014)
- Ran, F; Liu, Y; Wang, C; Xu, Z; Zhang, Y; Liu, Y; Zhao, G; Ling, Y Review of the development of BTK inhibitors in overcoming the clinical limitations of ibrutinib. Eur J Med Chem 229: (2022)
- PubChem, PC SAR analysis of Antagonists of XIAP-Bir3 domain of IAP-family anti-apoptotic proteins PubChem Bioassay (2009)
- Jamieson, C; Maclean, JK; Brown, CI; Campbell, RA; Gillen, KJ; Gillespie, J; Kazemier, B; Kiczun, M; Lamont, Y; Lyons, AJ; Moir, EM; Morrow, JA; Pantling, J; Rankovic, Z; Smith, L Structure based evolution of a novel series of positive modulators of the AMPA receptor. Bioorg Med Chem Lett 21: 805-11 (2011)
- Le Marec, O; Neveu, C; Lefranc, B; Dubessy, C; Boutin, JA; Do-Régo, JC; Costentin, J; Tonon, MC; Tena-Sempere, M; Vaudry, H; Leprince, J Structure-activity relationships of a series of analogues of the RFamide-related peptide 26RFa. J Med Chem 54: 4806-14 (2011)
- Caravatti, G; Rahuel, J; Gay, B; Furet, P Structure-based design of a non-peptidic antagonist of the SH2 domain of GRB2. Bioorg Med Chem Lett 9: 1973-8 (1999)
- Wustrow, DJ; Wise, LD; Cody, DM; MacKenzie, RG; Georgic, LM; Pugsley, TA; Heffner, TG Studies of the active conformation of a novel series of benzamide dopamine D2 agonists. J Med Chem 37: 4251-7 (1995)
- Wang, GT; Lane, B; Fesik, SW; Petros, A; Luly, J; Krafft, GA Synthesis and FKBP binding of small molecule mimics of the tricarbonyl region of FK506 Bioorg Med Chem Lett 4: 1161-1166 (1994)
- Noël, S; Hoegy, F; Rivault, F; Rognan, D; Schalk, IJ; Mislin, GL Synthesis and biological properties of thiazole-analogues of pyochelin, a siderophore of Pseudomonas aeruginosa. Bioorg Med Chem Lett 24: 132-5 (2013)
- Yokomatsu, T; Takechi, H; Akiyama, T; Shibuya, S; Kominato, T; Soeda, S; Shimeno, H Synthesis and evaluation of a difluoromethylene analogue of sphingomyelin as an inhibitor of sphingomyelinase. Bioorg Med Chem Lett 11: 1277-80 (2001)
- Baraldi, PG; Romagnoli, R; Tabrizi, MA; Falzoni, S; di Virgilio, F Synthesis of conformationally constrained analogues of KN62, a potent antagonist of the P2X7-receptor. Bioorg Med Chem Lett 10: 681-4 (2000)
- Tellier, F; Acher, F; Brabet, I; Pin, JP; Bockaert, J; Azerad, R Synthesis of conformationally-constrained stereospecific analogs of glutamic acid as antagonists of metabotropic receptors Bioorg Med Chem Lett 5: 2627-2632 (1995)
- Kramer, JB; Boschelli, DH; Connor, DT; Kostlan, CR; Flynn, DL; Dyer, RD; Bornemeier, DA; Kennedy, JA; Wright, CD; Kuipers, PJ Synthesis of reversed hydroxamic acids of indomethacin: dual inhibitors of cyclooxygenase and 5-lipoxygenase Bioorg Med Chem Lett 2: 1655-1660 (1992)
- Ocain, TD; Rich, DH Synthesis of sulfur-containing analogues of bestatin. Inhibition of aminopeptidases by alpha-thiolbestatin analogues. J Med Chem 31: 2193-9 (1988)
- Overhand, M; Pieterman, E; Cohen, LH; Valentijn, AR; Marel, GA; van Boom, JH Synthesis of triphosphonate analogues of farnesyl pyrophosphate. Inhibitors of squalene synthase and protein:farnesyl transferase Bioorg Med Chem Lett 7: 2435-2440 (1997)
- Wang, K; Zhang, H; Tian, Y The current strategies of optimization of oseltamivir against mutant neuraminidases of influenza A:A review. Eur J Med Chem 243: (2022)
- Epps, DE; Cheney, J; Schostarez, H; Sawyer, TK; Prairie, M; Krueger, WC; Mandel, F Thermodynamics of the interaction of inhibitors with the binding site of recombinant human renin. J Med Chem 33: 2080-6 (1990)
- Shibata, N; Nagai, K; Morita, Y; Ujikawa, O; Ohoka, N; Hattori, T; Koyama, R; Sano, O; Imaeda, Y; Nara, H; Cho, N; Naito, M Development of Protein Degradation Inducers of Androgen Receptor by Conjugation of Androgen Receptor Ligands and Inhibitor of Apoptosis Protein Ligands. J Med Chem 61: 543-575 (2018)
- Marchand, B; White, KL; Ly, JK; Margot, NA; Wang, R; McDermott, M; Miller, MD; Götte, M Effects of the translocation status of human immunodeficiency virus type 1 reverse transcriptase on the efficiency of excision of tenofovir. Antimicrob Agents Chemother 51: 2911-9 (2007)
- Deflorian, F; Kumar, TS; Phan, K; Gao, ZG; Xu, F; Wu, H; Katritch, V; Stevens, RC; Jacobson, KA Evaluation of molecular modeling of agonist binding in light of the crystallographic structure of an agonist-bound A2A adenosine receptor. J Med Chem 55: 538-52 (2012)
- Lundquist, JT; Harnish, DC; Kim, CY; Mehlmann, JF; Unwalla, RJ; Phipps, KM; Crawley, ML; Commons, T; Green, DM; Xu, W; Hum, WT; Eta, JE; Feingold, I; Patel, V; Evans, MJ; Lai, K; Borges-Marcucci, L; Mahaney, PE; Wrobel, JE Improvement of physiochemical properties of the tetrahydroazepinoindole series of farnesoid X receptor (FXR) agonists: beneficial modulation of lipids in primates. J Med Chem 53: 1774-87 (2010)
- Mortensen, DS; Perrin-Ninkovic, SM; Shevlin, G; Elsner, J; Zhao, J; Whitefield, B; Tehrani, L; Sapienza, J; Riggs, JR; Parnes, JS; Papa, P; Packard, G; Lee, BG; Harris, R; Correa, M; Bahmanyar, S; Richardson, SJ; Peng, SX; Leisten, J; Khambatta, G; Hickman, M; Gamez, JC; Bisonette, RR; Apuy, J; Cathers, BE; Canan, SS; Moghaddam, MF; Raymon, HK; Worland, P; Narla, RK; Fultz, KE; Sankar, S Optimization of a Series of Triazole Containing Mammalian Target of Rapamycin (mTOR) Kinase Inhibitors and the Discovery of CC-115. J Med Chem 58: 5599-608 (2015)
- Salmon-Chemin, L; Lemaire, A; De Freitas, S; Deprez, B; Sergheraert, C; Davioud-Charvet, E Parallel synthesis of a library of 1,4-naphthoquinones and automated screening of potential inhibitors of trypanothione reductase from Trypanosoma cruzi. Bioorg Med Chem Lett 10: 631-5 (2000)
- Rycek, L; Ticli, V; Pyszkowski, J; Latkolik, S; Liu, X; Atanasov, AG; Steinacher, T; Bauer, R; Schuster, D; Dirsch, VM; Schnürch, M; Ernst, M; Mihovilovic, MD Stereoselective Synthesis of the Isomers of Notoincisol A: Assigment of the Absolute Configuration of this Natural Product and Biological Evaluation. J Nat Prod 81: 2419-2428 (2018)
- Kozikowski, AP; Wang, S; Ma, D; Yao, J; Ahmad, S; Glazer, RI; Bogi, K; Acs, P; Modarres, S; Lewin, NE; Blumberg, PM Modeling, chemistry, and biology of the benzolactam analogues of indolactam V (ILV). 2. Identification of the binding site of the benzolactams in the CRD2 activator-binding domain of PKCdelta and discovery of an ILV analogue of improved isozyme selectivity. J Med Chem 40: 1316-26 (1997)
- Lyne, PD; Lamb, ML; Saeh, JC Accurate prediction of the relative potencies of members of a series of kinase inhibitors using molecular docking and MM-GBSA scoring. J Med Chem 49: 4805-8 (2006)
- Tochowicz, A; Santucci, M; Saxena, P; Guaitoli, G; Trande, M; Finer-Moore, J; Stroud, RM; Costi, MP Alanine mutants of the interface residues of human thymidylate synthase decode key features of the binding mode of allosteric anticancer peptides. J Med Chem 58: 1012-8 (2015)
- Brandt, P; Geitmann, M; Danielson, UH Deconstruction of non-nucleoside reverse transcriptase inhibitors of human immunodeficiency virus type 1 for exploration of the optimization landscape of fragments. J Med Chem 54: 709-18 (2011)
- Julémont, F; de Leval, X; Michaux, C; Damas, J; Charlier, C; Durant, F; Pirotte, B; Dogné, JM Spectral and crystallographic study of pyridinic analogues of nimesulide: determination of the active form of methanesulfonamides as COX-2 selective inhibitors. J Med Chem 45: 5182-5 (2002)
- Nieland, NP; Moynihan, HA; Carrington, S; Broadbear, J; Woods, JH; Traynor, JR; Husbands, SM; Lewis, JW Structural determinants of opioid activity in derivatives of 14-aminomorphinones: effect of substitution in the aromatic ring of cinnamoylaminomorphinones and codeinones. J Med Chem 49: 5333-8 (2006)
- Coutts, SJ; Kelly, TA; Snow, RJ; Kennedy, CA; Barton, RW; Adams, J; Krolikowski, DA; Freeman, DM; Campbell, SJ; Ksiazek, JF; Bachovchin, WW Structure-activity relationships of boronic acid inhibitors of dipeptidyl peptidase IV. 1. Variation of the P2 position of Xaa-boroPro dipeptides. J Med Chem 39: 2087-94 (1996)
- Rodriguez, M; Lignon, MF; Galas, MC; Fulcrand, P; Mendre, C; Aumelas, A; Laur, J; Martinez, J Synthesis and biological activities of pseudopeptide analogues of the C-terminal heptapeptide of cholecystokinin. On the importance of the peptide bonds. J Med Chem 30: 1366-73 (1987)
- Ferrari, AM; Degliesposti, G; Sgobba, M; Rastelli, G Validation of an automated procedure for the prediction of relative free energies of binding on a set of aldose reductase inhibitors. Bioorg Med Chem 15: 7865-77 (2007)
- Alverez, C; Bulfer, SL; Chakrasali, R; Chimenti, MS; Deshaies, RJ; Green, N; Kelly, M; LaPorte, MG; Lewis, TS; Liang, M; Moore, WJ; Neitz, RJ; Peshkov, VA; Walters, MA; Zhang, F; Arkin, MR; Wipf, P; Huryn, DM Allosteric Indole Amide Inhibitors of p97: Identification of a Novel Probe of the Ubiquitin Pathway. ACS Med Chem Lett 7: 182-7 (2016)
- Loizidou, EZ; Zeinalipour-Yazdi, CD; Christofides, T; Kostrikis, LG Analysis of binding parameters of HIV-1 integrase inhibitors: correlates of drug inhibition and resistance. Bioorg Med Chem 17: 4806-18 (2009)
- Hocková, D; Janeba, Z; Naesens, L; Edstein, MD; Chavchich, M; Keough, DT; Guddat, LW Antimalarial activity of prodrugs of N-branched acyclic nucleoside phosphonate inhibitors of 6-oxopurine phosphoribosyltransferases. Bioorg Med Chem 23: 5502-10 (2015)
- Cardozo, MG; Kawai, T; Iimura, Y; Sugimoto, H; Yamanishi, Y; Hopfinger, AJ Conformational analyses and molecular-shape comparisons of a series of indanone-benzylpiperidine inhibitors of acetylcholinesterase. J Med Chem 35: 590-601 (1992)
- Bergeron, P; Koehler, MF; Blackwood, EM; Bowman, K; Clark, K; Firestein, R; Kiefer, JR; Maskos, K; McCleland, ML; Orren, L; Ramaswamy, S; Salphati, L; Schmidt, S; Schneider, EV; Wu, J; Beresini, M Design and Development of a Series of Potent and Selective Type II Inhibitors of CDK8. ACS Med Chem Lett 7: 595-600 (2016)
- Poduch, E; Bello, AM; Tang, S; Fujihashi, M; Pai, EF; Kotra, LP Design of inhibitors of orotidine monophosphate decarboxylase using bioisosteric replacement and determination of inhibition kinetics. J Med Chem 49: 4937-45 (2006)
- Sun, W; Nikolovska-Coleska, Z; Qin, D; Sun, H; Yang, CY; Bai, L; Qiu, S; Wang, Y; Ma, D; Wang, S Design, synthesis, and evaluation of potent, nonpeptidic mimetics of second mitochondria-derived activator of caspases. J Med Chem 52: 593-6 (2009)
- Hutchinson, JH; Prasit, P; Choo, LY; Riendeau, D; Charleson, S; Evans, JF; Piechuta, H; Ball, RG Development of L-689,065 - the prototype of a new class of potent 5-lipoxygenase inhibitors Bioorg Med Chem Lett 2: 1699-1702 (1992)
- Fleming, MC; Chiou, LF; Tumbale, PP; Droby, GN; Lim, J; Norris-Drouin, JL; Williams, JG; Pearce, KH; Williams, RS; Vaziri, C; Bowers, AA Discovery and Structural Basis of the Selectivity of Potent Cyclic Peptide Inhibitors of MAGE-A4. J Med Chem 65: 7231-7245 (2022)
- Schoepfer, J; Jahnke, W; Berellini, G; Buonamici, S; Cotesta, S; Cowan-Jacob, SW; Dodd, S; Drueckes, P; Fabbro, D; Gabriel, T; Groell, JM; Grotzfeld, RM; Hassan, AQ; Henry, C; Iyer, V; Jones, D; Lombardo, F; Loo, A; Manley, PW; Pellé, X; Rummel, G; Salem, B; Warmuth, M; Wylie, AA; Zoller, T; Marzinzik, AL; Furet, P Discovery of Asciminib (ABL001), an Allosteric Inhibitor of the Tyrosine Kinase Activity of BCR-ABL1. J Med Chem 61: 8120-8135 (2018)
- Knight, SD; Adams, ND; Burgess, JL; Chaudhari, AM; Darcy, MG; Donatelli, CA; Luengo, JI; Newlander, KA; Parrish, CA; Ridgers, LH; Sarpong, MA; Schmidt, SJ; Van Aller, GS; Carson, JD; Diamond, MA; Elkins, PA; Gardiner, CM; Garver, E; Gilbert, SA; Gontarek, RR; Jackson, JR; Kershner, KL; Luo, L; Raha, K; Sherk, CS; Sung, CM; Sutton, D; Tummino, PJ; Wegrzyn, RJ; Auger, KR; Dhanak, D Discovery of GSK2126458, a Highly Potent Inhibitor of PI3K and the Mammalian Target of Rapamycin. ACS Med Chem Lett 1: 39-43
- Winters, MP; Sui, Z; Wall, M; Wang, Y; Gunnet, J; Leonard, J; Hua, H; Yan, W; Suckow, A; Bell, A; Clapper, W; Jenkinson, C; Haug, P; Koudriakova, T; Huebert, N; Murray, WV Discovery of N-arylpyrroles as agonists of GPR120 for the treatment of type II diabetes. Bioorg Med Chem Lett 28: 841-846 (2018)
- Tian, H; You, S; Xiong, T; Ji, M; Zhang, K; Jiang, L; Du, T; Li, Y; Liu, W; Lin, S; Chen, X; Xu, H Discovery of a Novel Photocaged PI3K Inhibitor Capable of Real-Time Reporting of Drug Release. ACS Med Chem Lett 14: 1100-1107 (2023)
- Hao, Q; Shi, J; Zhang, Z; Yang, G; Zhi, Y; Wang, K; Ma, D; Fu, S; Dong, H; Zhi, Z; Zhang, W; Li, T; Wang, J Discovery of a novel class of reversible monoacylglycerol lipase inhibitors for potential treatment of depression. Eur J Med Chem 268:
- Schoenfeld, RC; Bourdet, DL; Brameld, KA; Chin, E; de Vicente, J; Fung, A; Harris, SF; Lee, EK; Le Pogam, S; Leveque, V; Li, J; Lui, AS; Najera, I; Rajyaguru, S; Sangi, M; Steiner, S; Talamas, FX; Taygerly, JP; Zhao, J Discovery of a novel series of potent non-nucleoside inhibitors of hepatitis C virus NS5B. J Med Chem 56: 8163-82 (2013)
- Freskos, JN; Mischke, BV; DeCrescenzo, GA; Heintz, R; Getman, DP; Howard, SC; Kishore, NN; McDonald, JJ; Munie, GE; Rangwala, S; Swearingen, CA; Voliva, C; Welsch, DJ Discovery of a novel series of selective MMP inhibitors: identification of the gamma-sulfone-thiols. Bioorg Med Chem Lett 9: 943-8 (1999)
- Gong, H; Yang, M; Xiao, Z; Doweyko, AM; Cunningham, M; Wang, J; Habte, S; Holloway, D; Burke, C; Shuster, D; Gao, L; Carman, J; Somerville, JE; Nadler, SG; Salter-Cid, L; Barrish, JC; Weinstein, DS Discovery of acylurea isosteres of 2-acylaminothiadiazole in the azaxanthene series of glucocorticoid receptor agonists. Bioorg Med Chem Lett 24: 3268-73 (2014)
- Richards, S; Sorensen, B; Jae, HS; Winn, M; Chen, Y; Wang, J; Fung, S; Monzon, K; Frevert, EU; Jacobson, P; Sham, H; Link, JT Discovery of potent and selective inhibitors of 11beta-HSD1 for the treatment of metabolic syndrome. Bioorg Med Chem Lett 16: 6241-5 (2006)
- Perez, HL; Chaudhry, C; Emanuel, SL; Fanslau, C; Fargnoli, J; Gan, J; Kim, KS; Lei, M; Naglich, JG; Traeger, SC; Vuppugalla, R; Wei, DD; Vite, GD; Talbott, RL; Borzilleri, RM Discovery of potent heterodimeric antagonists of inhibitor of apoptosis proteins (IAPs) with sustained antitumor activity. J Med Chem 58: 1556-62 (2015)
- Spiegel, PC; Kaiser, SM; Simon, JA; Stoddard, BL Disruption of protein-membrane binding and identification of small-molecule inhibitors of coagulation factor VIII. Chem Biol 11: 1413-22 (2004)
- Giorgetti, S; Raimondi, S; Pagano, K; Relini, A; Bucciantini, M; Corazza, A; Fogolari, F; Codutti, L; Salmona, M; Mangione, P; Colombo, L; De Luigi, A; Porcari, R; Gliozzi, A; Stefani, M; Esposito, G; Bellotti, V; Stoppini, M Effect of tetracyclines on the dynamics of formation and destructuration of beta2-microglobulin amyloid fibrils. J Biol Chem 286: 2121-31 (2011)
- Schirmeister, T; Schmitz, J; Jung, S; Schmenger, T; Krauth-Siegel, RL; Gütschow, M Evaluation of dipeptide nitriles as inhibitors of rhodesain, a major cysteine protease of Trypanosoma brucei. Bioorg Med Chem Lett 27: 45-50 (2017)
- Hunt, JR; Kleindl, PA; Moulder, KR; Prisinzano, TE; Forrest, ML Further exploration of the structure-activity relationship of imidazoquinolines; identification of potent C7-substituted imidazoquinolines. Bioorg Med Chem Lett 30: (2020)
- Labrière, C; Gong, H; Finlay, BB; Reiner, NE; Young, RN Further investigation of inhibitors of MRSA pyruvate kinase: Towards the conception of novel antimicrobial agents. Eur J Med Chem 125: 1-13 (2017)
- Kawamura, T; Matsubara, K; Otaka, H; Tashiro, E; Shindo, K; Yanagita, RC; Irie, K; Imoto, M Generation of 'Unnatural Natural Product' library and identification of a small molecule inhibitor of XIAP. Bioorg Med Chem 19: 4377-85 (2011)
- Wurst, JM; Drake, EJ; Theriault, JR; Jewett, IT; VerPlank, L; Perez, JR; Dandapani, S; Palmer, M; Moskowitz, SM; Schreiber, SL; Munoz, B; Gulick, AM Identification of Inhibitors of PvdQ, an Enzyme Involved in the Synthesis of the Siderophore Pyoverdine. ACS Chem Biol 9: 1536-44 (2014)
- Fink, BE; Gavai, AV; Tokarski, JS; Goyal, B; Misra, R; Xiao, HY; Kimball, SD; Han, WC; Norris, D; Spires, TE; You, D; Gottardis, MM; Lorenzi, MV; Vite, GD Identification of a novel series of tetrahydrodibenzazocines as inhibitors of 17beta-hydroxysteroid dehydrogenase type 3. Bioorg Med Chem Lett 16: 1532-6 (2006)
- Liu, Y; Donner, PL; Pratt, JK; Jiang, WW; Ng, T; Gracias, V; Baumeister, S; Wiedeman, PE; Traphagen, L; Warrior, U; Maring, C; Kati, WM; Djuric, SW; Molla, A Identification of halosalicylamide derivatives as a novel class of allosteric inhibitors of HCV NS5B polymerase. Bioorg Med Chem Lett 18: 3173-7 (2008)
- Wolkenberg, SE; Zhao, Z; Kapitskaya, M; Webber, AL; Petrukhin, K; Tang, YS; Dean, DC; Hartman, GD; Lindsley, CW Identification of potent agonists of photoreceptor-specific nuclear receptor (NR2E3) and preparation of a radioligand. Bioorg Med Chem Lett 16: 5001-4 (2006)
- Kozlova, A; Thabault, L; Dauguet, N; Deskeuvre, M; Stroobant, V; Pilotte, L; Liberelle, M; Van den Eynde, B; Frédérick, R Investigation of chalcogen bioisosteric replacement in a series of heterocyclic inhibitors of tryptophan 2,3-dioxygenase. Eur J Med Chem 227: (2022)
- Fathi, AR; Krautheim, A; Kaap, S; Eger, K; Steinfelder, HJ Michael adducts of ascorbic acid as inhibitors of protein phosphatase 2A and inducers of apoptosis. Bioorg Med Chem Lett 10: 1605-8 (2000)
- Jorgensen, WL Non-Covalent Inhibitors of the Main Protease of SARS-CoV-2 and Methods of Use US Patent US20240092759 (2024)
- Munoz, L; Kavanagh, ME; Phoa, AF; Heng, B; Dzamko, N; Chen, EJ; Doddareddy, MR; Guillemin, GJ; Kassiou, M Optimisation of LRRK2 inhibitors and assessment of functional efficacy in cell-based models of neuroinflammation. Eur J Med Chem 95: 29-34 (2015)
- Harcken, C; Riether, D; Liu, P; Razavi, H; Patel, U; Lee, T; Bosanac, T; Ward, Y; Ralph, M; Chen, Z; Souza, D; Nelson, RM; Kukulka, A; Fadra-Khan, TN; Zuvela-Jelaska, L; Patel, M; Thomson, DS; Nabozny, GH Optimization of drug-like properties of nonsteroidal glucocorticoid mimetics and identification of a clinical candidate. ACS Med Chem Lett 5: 1318-23 (2014)
- Mayhoub, AS; Marler, L; Kondratyuk, TP; Park, EJ; Pezzuto, JM; Cushman, M Optimization of thiazole analogues of resveratrol for induction of NAD(P)H:quinone reductase 1 (QR1). Bioorg Med Chem 20: 7030-9 (2012)
- Van Rompaey, L; Galien, R; van der Aar, EM; Clement-Lacroix, P; Nelles, L; Smets, B; Lepescheux, L; Christophe, T; Conrath, K; Vandeghinste, N; Vayssiere, B; De Vos, S; Fletcher, S; Brys, R; van 't Klooster, G; Feyen, JH; Menet, C Preclinical characterization of GLPG0634, a selective inhibitor of JAK1, for the treatment of inflammatory diseases. J Immunol 191: 3568-77
- Walby, GD; Martin, SF Preparation of novel analogs of 2-arylpiperidines and evaluation of their sigma receptor binding affinities. Eur J Med Chem 235: (2022)
- Blum, E; Zhang, J; Zaluski, J; Einstein, DE; Korshin, EE; Kubas, A; Gruzman, A; Tochtrop, GP; Kiser, PD; Palczewski, K Rational Alteration of Pharmacokinetics of Chiral Fluorinated and Deuterated Derivatives of Emixustat for Retinal Therapy. J Med Chem 64: 8287-8302 (2021)
- Sham, HL; Bolis, G; Stein, HH; Fesik, SW; Marcotte, PA; Plattner, JJ; Rempel, CA; Greer, J Renin inhibitors. Design and synthesis of a new class of conformationally restricted analogues of angiotensinogen. J Med Chem 31: 284-95 (1988)
- Endo, Y; Yokoyama, A Role of the hydrophobic moiety of tumor promoters. Synthesis and activity of 2-alkylated benzolactams. Bioorg Med Chem Lett 10: 63-6 (2000)
- Summers, JB; Gunn, BP; Martin, JG; Martin, MB; Mazdiyasni, H; Stewart, AO; Young, PR; Bouska, JB; Goetze, AM; Dyer, RD Structure-activity analysis of a class of orally active hydroxamic acid inhibitors of leukotriene biosynthesis. J Med Chem 31: 1960-4 (1988)
- Choe, H; Kim, J; Hong, S Structure-based design of flavone-based inhibitors of wild-type and T315I mutant of ABL. Bioorg Med Chem Lett 23: 4324-7 (2013)
- Guida, WC; Elliott, RD; Thomas, HJ; Secrist, JA; Babu, YS; Bugg, CE; Erion, MD; Ealick, SE; Montgomery, JA Structure-based design of inhibitors of purine nucleoside phosphorylase. 4. A study of phosphate mimics. J Med Chem 37: 1109-14 (1994)
- Artis, DR; Brotherton-Pleiss, C; Pease, JH; Lin, CJ; Ferla, SW; Newman, SR; Bhakta, S; Ostrelich, H; Jarnagin, K Structure-based design of six novel classes of nonpeptide antagonists of the bradykinin B2 receptor. Bioorg Med Chem Lett 10: 2421-5 (2001)
- Wen, WH; Lin, M; Su, CY; Wang, SY; Cheng, YS; Fang, JM; Wong, CH Synergistic effect of zanamivir-porphyrin conjugates on inhibition of neuraminidase and inactivation of influenza virus. J Med Chem 52: 4903-10 (2009)
- Sharma, S; Peng, Q; Vadukoot, AK; Aretz, CD; Jensen, AA; Wallick, AI; Dong, X; Hopkins, CR Synthesis and Biological Characterization of a Series of 2-Sulfonamidebenzamides as Allosteric Modulators of MrgX1. ACS Med Chem Lett 13: 841-847 (2022)
- Daley, L; Guminski, Y; Demerseman, P; Kruczynski, A; Etiévant, C; Imbert, T; Hill, BT; Monneret, C Synthesis and antitumor activity of new glycosides of epipodophyllotoxin, analogues of etoposide, and NK 611. J Med Chem 41: 4475-85 (1998)
- Krapf, MK; Gallus, J; Spindler, A; Wiese, M Synthesis and biological evaluation of quinazoline derivatives - A SAR study of novel inhibitors of ABCG2. Eur J Med Chem 161: 506-525 (2019)
- Solum, EJ; Cheng, JJ; Sørvik, IB; Paulsen, RE; Vik, A; Hansen, TV Synthesis and biological evaluations of new analogs of 2-methoxyestradiol: inhibitors of tubulin and angiogenesis. Eur J Med Chem 85: 391-8 (2014)
- Flentge, CA; Randolph, JT; Huang, PP; Klein, LL; Marsh, KC; Harlan, JE; Kempf, DJ Synthesis and evaluation of inhibitors of cytochrome P450 3A (CYP3A) for pharmacokinetic enhancement of drugs. Bioorg Med Chem Lett 19: 5444-8 (2009)
- Dutta, S; Malla, RK; Bandyopadhyay, S; Spilling, CD; Dupureur, CM Synthesis and kinetic analysis of some phosphonate analogs of cyclophostin as inhibitors of human acetylcholinesterase. Bioorg Med Chem 18: 2265-74 (2010)
- Legraverend, M; Ludwig, O; Bisagni, E; Leclerc, S; Meijer, L Synthesis of C2 alkynylated purines, a new family of potent inhibitors of cyclin-dependent kinases. Bioorg Med Chem Lett 8: 793-8 (1998)
- Hanashima, S; Korekane, H; Taniguchi, N; Yamaguchi, Y Synthesis of N-glycan units for assessment of substrate structural requirements of N-acetylglucosaminyltransferase III. Bioorg Med Chem Lett 24: 4533-7 (2014)
- Vaghefi, MM; Bernacki, RJ; Dalley, NK; Wilson, BE; Robins, RK Synthesis of glycopyranosylphosphonate analogues of certain natural nucleoside diphosphate sugars as potential inhibitors of glycosyltransferases. J Med Chem 30: 1383-91 (1987)
- Pankiewicz, KW; Zeidler, J; Ciszewski, LA; Bell, JE; Goldstein, BM; Jayaram, HN; Watanabe, KA Synthesis of isosteric analogues of nicotinamide adenine dinucleotide containing C-nucleotide of nicotinamide or picolinamide. J Med Chem 36: 1855-9 (1993)
- Portoghese, PS; Sultana, M; Moe, ST; Takemori, AE Synthesis of naltrexone-derived delta-opioid antagonists. Role of conformation of the delta address moiety. J Med Chem 37: 579-85 (1994)
- Wang, QQ; Cheng, N; Zheng, XW; Peng, SM; Zou, XQ Synthesis of organic nitrates of luteolin as a novel class of potent aldose reductase inhibitors. Bioorg Med Chem 21: 4301-10 (2013)
- Cisneros, JA; Robertson, MJ; Mercado, BQ; Jorgensen, WL Systematic Study of Effects of Structural Modifications on the Aqueous Solubility of Drug-like Molecules. ACS Med Chem Lett 8: 124-127 (2017)
- Lowe, JA; Hou, X; Schmidt, C; David Tingley, F; McHardy, S; Kalman, M; Deninno, S; Sanner, M; Ward, K; Lebel, L; Tunucci, D; Valentine, J; Bronk, BS; Schaeffer, E The discovery of a structurally novel class of inhibitors of the type 1 glycine transporter. Bioorg Med Chem Lett 19: 2974-6 (2009)
- Stanton, JL; Ksander, GM; Jesus, Rd; Sperbeck, DM The effect of heteroatom substitution on a series of phosphonate inhibitors of neutral endopeptidase 24.11 Bioorg Med Chem Lett 4: 539-542 (1994)
- Sciotti, RJ; Pliushchev, M; Wiedeman, PE; Balli, D; Flamm, R; Nilius, AM; Marsh, K; Stolarik, D; Jolly, R; Ulrich, R; Djuric, SW The synthesis and biological evaluation of a novel series of antimicrobials of the oxazolidinone class. Bioorg Med Chem Lett 12: 2121-3 (2002)
- Appendino, G; Daddario, N; Minassi, A; Moriello, AS; De Petrocellis, L; Di Marzo, V The taming of capsaicin. Reversal of the vanilloid activity of N-acylvanillamines by aromatic iodination. J Med Chem 48: 4663-9 (2005)
- Hom, RK; Huang, T; Gailunas, AF; Wang, C; Mamo, S; Maras, B; Fang, LY; Barra, D; Tung, JS; Schirch, V; Walker, DE; Davis, D; Thorsett, ED; Jewett, NE; Moon, JB; John, V Thermodynamic analysis of the binding of the polyglutamate chain of 5-formyltetrahydropteroylpolyglutamates to serine hydroxymethyltransferase. Biochemistry 37: 13536-42 (1998)
- Liu, TD; Chen, Y; Wu, M; Cheng, M; Chen, H; Wu, W; Chen, K; Lin, Y; Yuan, G Use of azaphilone compounds for the modulation of the activity of a nuclear hormone receptor US Patent US8957057 (2015)
- Luk, KC; Simcox, ME; Schutt, A; Rowan, K; Thompson, T; Chen, Y; Kammlott, U; DePinto, W; Dunten, P; Dermatakis, A A new series of potent oxindole inhibitors of CDK2. Bioorg Med Chem Lett 14: 913-7 (2004)
- Yi, F; Regan, L A novel class of small molecule inhibitors of Hsp90. ACS Chem Biol 3: 645-54 (2008)
- PubChem, PC AlphaScreen confirmatory assay for validation of inhibitors of SUMOylation PubChem Bioassay (2010)
- Prell, E; Csuk, R Amplification of the inhibitory activity of miglitol by monofluorination. Bioorg Med Chem Lett 19: 5673-4 (2009)
- Banwell, MG; Crasto, CF; Easton, CJ; Forrest, AK; Karoli, T; March, DR; Mensah, L; Nairn, MR; O'Hanlon, PJ; Oldham, MD; Yue, W Analogues of SB-203207 as inhibitors of tRNA synthetases. Bioorg Med Chem Lett 10: 2263-6 (2001)
- Alilou, M; Dibwe, DF; Schwaiger, S; Khodami, M; Troppmair, J; Awale, S; Stuppner, H Antiausterity Activity of Secondary Metabolites from the Roots of J Nat Prod 83: 1099-1106 (2020)
- Bisson, WH; Zhang, Z; Welsh, K; Huang, JW; Ryan, J; Reed, JC; Pellecchia, M Binding properties of the C-terminal domain of VIAF. Chem Biol Drug Des 72: 331-6 (2008)
- Seenadera, SPD; Long, SA; Akee, R; Bermudez, G; Parsonage, G; Strope, J; Peer, C; Figg, WD; Parker, KA; Beech, DJ; Beutler, JA Biological Effects of Modifications of the Englerin A Glycolate. ACS Med Chem Lett 13: 1472-1476 (2022)
- Taguchi, M; Goda, K; Sugimoto, K; Akama, T; Yamamoto, K; Suzuki, T; Tomishima, Y; Nishiguchi, M; Arai, K; Takahashi, K; Kobori, T Biological evaluation of sphingomyelin analogues as inhibitors of sphingomyelinase. Bioorg Med Chem Lett 13: 3681-4 (2003)
- Thomas, GJ; Bushnell, DJ; Martin, JA Carbocyclic analogues of hydroxyethylamine containing inhibitors of HIV proteinase Bioorg Med Chem Lett 4: 2759-2762 (1994)
- Vardy, E; Mosier, PD; Frankowski, KJ; Wu, H; Katritch, V; Westkaemper, RB; Aubé, J; Stevens, RC; Roth, BL Chemotype-selective modes of action of ¿-opioid receptor agonists. J Biol Chem 288: 34470-83 (2013)
- Hiesinger, K; Kramer, JS; Achenbach, J; Moser, D; Weber, J; Wittmann, SK; Morisseau, C; Angioni, C; Geisslinger, G; Kahnt, AS; Kaiser, A; Proschak, A; Steinhilber, D; Pogoryelov, D; Wagner, K; Hammock, BD; Proschak, E Computer-Aided Selective Optimization of Side Activities of Talinolol. ACS Med Chem Lett 10: 899-903 (2019)
- Beard, DJ; Perrine, SA; Phillips, E; Hoque, S; Conerly, S; Tichenor, C; Simmons, MA; Young, JK Conformational comparisons of a series of tachykinin peptide analogs. J Med Chem 50: 6501-6 (2007)
- Singh, SB Confronting the challenges of discovery of novel antibacterial agents. Bioorg Med Chem Lett 24: 3683-9 (2014)
- Stierle, AA; Stierle, DB; Decato, D; Alverson, J; Apedaile, L Cryptic Biosynthesis of the Berkeleypenostatins from Coculture of Extremophilic J Nat Prod 84: 1656-1665 (2021)
- Zhou, T; Parillon, L; Li, F; Wang, Y; Keats, J; Lamore, S; Xu, Q; Shakespeare, W; Dalgarno, D; Zhu, X Crystal structure of the T315I mutant of AbI kinase. Chem Biol Drug Des 70: 171-81 (2007)
- Wythes, MJ; McAlpine, IJ; Patman, R; Rui, EY; Maderna, A; Jalaie, M; Gajiwala, KS Cyclopentane-based modulators of STING (stimulator of interferon genes) US Patent US10968242 (2021)
- Johnson, RC; Boettcher, BR; Cherpeck, RE; Dolson, MG Design and Synthesis of Potent Inhibitors of Glutamine Synthetase Bioorg Chem 18: 154-9 (1990)
- Brown, A; Brown, L; Ellis, D; Puhalo, N; Smith, CR; Wallace, O; Watson, L Design and optimization of potent, selective antagonists of Oxytocin. Bioorg Med Chem Lett 18: 4278-81 (2008)
- Bhalay, G; Albrecht, B; Akhlaq, M; Baettig, U; Beer, D; Brown, Z; Charlton, S; Dunstan, A; Bradley, M; Gedeck, P; Glen, A; Howe, T; Keller, T; Leighton-Davies, J; Li, A; McCarthy, C; Mocquet, C; Owen, C; Nicklin, P; Rosethorne, E Design and synthesis of a library of chemokine antagonists. Bioorg Med Chem Lett 21: 6249-52 (2011)
- Goldring, AO; Balzarini, J; Gilbert, IH Design and synthesis of bio-isosteres of thymidine triphosphate. Bioorg Med Chem Lett 8: 1211-4 (1999)
- Dredar, SA; Blankenship, JW; Marchant, PE; Manneh, V; Fries, DS Design and synthesis of inhibitors of N8-acetylspermidine deacetylase. J Med Chem 32: 984-9 (1989)
- Bäurle, S; Blume, T; Günther, J; Henschel, D; Hillig, RC; Husemann, M; Mengel, A; Parchmann, C; Schmid, E; Skuballa, W Design and synthesis of macrocyclic inhibitors of phosphatase cdc25B. Bioorg Med Chem Lett 14: 1673-7 (2004)
- Wang, X; Choe, Y; Craik, CS; Ellman, JA Design and synthesis of novel inhibitors of gelatinase B. Bioorg Med Chem Lett 12: 2201-4 (2002)
- Farrington, GK; Kumar, A; Wedler, FC Design and synthesis of phosphonate inhibitors of glutamine synthetase. J Med Chem 30: 2062-7 (1987)
- Colombo, E; Désilets, A; Duchêne, D; Chagnon, F; Najmanovich, R; Leduc, R; Marsault, E Design and synthesis of potent, selective inhibitors of matriptase. ACS Med Chem Lett 3: 530-534 (2012)
- Lu, Z; Napolitano, JB; Theberge, A; Ali, A; Hammond, ML; Tan, E; Tong, X; Xu, SS; Latham, MJ; Peterson, LB; Anderson, MS; Eveland, SS; Guo, Q; Hyland, SA; Milot, DP; Chen, Y; Sparrow, CP; Wright, SD; Sinclair, PJ Design of a novel class of biphenyl CETP inhibitors. Bioorg Med Chem Lett 20: 7469-72 (2010)
- Tung, JS; Davis, DL; Anderson, JP; Walker, DE; Mamo, S; Jewett, N; Hom, RK; Sinha, S; Thorsett, ED; John, V Design of substrate-based inhibitors of human beta-secretase. J Med Chem 45: 259-62 (2002)
- Ritzefeld, M; Zhang, L; Xiao, Z; Andrei, SA; Boyd, O; Masumoto, N; Rodgers, UR; Artelsmair, M; Sefer, L; Hayes, A; Gavriil, ES; Raynaud, FI; Burke, R; Blagg, J; Rzepa, HS; Siebold, C; Magee, AI; Lanyon-Hogg, T; Tate, EW Design, Synthesis, and Evaluation of Inhibitors of Hedgehog Acyltransferase. J Med Chem 67: 1061-1078 (2024)
- Wang, D; Chu, PC; Yang, CN; Yan, R; Chuang, YC; Kulp, SK; Chen, CS Development of a novel class of glucose transporter inhibitors. J Med Chem 55: 3827-36 (2012)
- Tong, L; Kim, SH; Chen, L; Kosinski, A; Shankar, BB; Girijavallabhan, V; Yang, DY; Yu, W; Zhou, G; Shih, NY; Chen, S; Hu, M; Lundell, D; Niu, X; Umland, S; Kozlowski, JA Development of a prodrug of hydantoin based TACE inhibitor. Bioorg Med Chem Lett 27: 3704-3708 (2017)
- Thomson, CG; Le Grand, D; Dowling, M; Beattie, D; Elphick, L; Faller, M; Freeman, M; Hardaker, E; Head, V; Hemmig, R; Hill, J; Lister, A; Pascoe, D; Rieffel, S; Shrestha, B; Steward, O; Zink, F Development of autotaxin inhibitors: A series of tetrazole cinnamides. Bioorg Med Chem Lett 31: (2021)
- Haberman, VA; Fleming, SR; Leisner, TM; Puhl, AC; Feng, E; Xie, L; Chen, X; Goto, Y; Suga, H; Parise, LV; Kireev, D; Pearce, KH; Bowers, AA Discovery and Development of Cyclic Peptide Inhibitors of CIB1. ACS Med Chem Lett 12: 1832-1839 (2021)
- Wang, Y; Dai, Y; Wu, X; Li, F; Liu, B; Li, C; Liu, Q; Zhou, Y; Wang, B; Zhu, M; Cui, R; Tan, X; Xiong, Z; Liu, J; Tan, M; Xu, Y; Geng, M; Jiang, H; Liu, H; Ai, J; Zheng, M Discovery and Development of a Series of Pyrazolo[3,4- J Med Chem 62: 7473-7488 (2019)
- Daniels, MH; Malojcic, G; Clugston, SL; Williams, B; Coeffet-Le Gal, M; Pan-Zhou, XR; Venkatachalan, S; Harmange, JC; Ledeboer, M Discovery and Optimization of Highly Selective Inhibitors of CDK5. J Med Chem 65: 3575-3596 (2022)
- Richards, S; Larson, CJ; Koltun, ES; Hanel, A; Chan, V; Nachtigall, J; Harrison, A; Aay, N; Du, H; Arcalas, A; Galan, A; Zhang, J; Zhang, W; Won, KA; Tam, D; Qian, F; Wang, T; Finn, P; Ogilvie, K; Rosen, J; Aoyama, R; Plonowski, A; Cancilla, B; Bentzien, F; Yakes, M; Mohan, R; Lamb, P; Nuss, J; Kearney, P Discovery and characterization of an inhibitor of glucosylceramide synthase. J Med Chem 55: 4322-35 (2012)
- Rolfe, A; Yao, S; Nguyen, TV; Omoto, K; Colombo, F; Virrankoski, M; Vaillancourt, FH; Yu, L; Cook, A; Reynolds, D; Ioannidis, S; Zhu, P; Larsen, NA; Bolduc, DM Discovery of 2,6-Dimethylpiperazines as Allosteric Inhibitors of CPS1. ACS Med Chem Lett 11: 1305-1309 (2020)
- Babault, N; Allali-Hassani, A; Li, F; Fan, J; Yue, A; Ju, K; Liu, F; Vedadi, M; Liu, J; Jin, J Discovery of Bisubstrate Inhibitors of Nicotinamide N-Methyltransferase (NNMT). J Med Chem 61: 1541-1551 (2018)
- Lu, T; Lu, H; Duan, Z; Wang, J; Han, J; Xiao, S; Chen, H; Jiang, H; Chen, Y; Yang, F; Li, Q; Chen, D; Lin, J; Li, B; Jiang, H; Chen, K; Lu, W; Lin, H; Luo, C Discovery of High-Affinity Inhibitors of the BPTF Bromodomain. J Med Chem 64: 12075-12088 (2021)
- Trilles, R; Beglov, D; Chen, Q; He, H; Wireman, R; Reed, A; Chennamadhavuni, S; Panek, JS; Brown, LE; Vajda, S; Porco, JA; Kelley, MR; Georgiadis, MM Discovery of Macrocyclic Inhibitors of Apurinic/Apyrimidinic Endonuclease 1. J Med Chem 62: 1971-1988 (2019)
- Fader, L; Brault, M; Desjardins, J; Dansereau, N; Lamorte, L; Tremblay, S; Bilodeau, F; Bordeleau, J; Duplessis, M; Gorys, V; Gillard, J; Gleason, JL; James, C; Joly, MA; Kuhn, C; Llinas-Brunet, M; Luo, L; Morency, L; Morin, S; Parisien, M; Poirier, M; Thibeault, C; Trinh, T; Sturino, C; Srivastava, S; Yoakim, C; Franti, M Discovery of Potent, Orally Bioavailable Inhibitors of Human Cytomegalovirus. ACS Med Chem Lett 7: 525-30 (2016)
- Maben, Z; Arya, R; Rane, D; An, WF; Metkar, S; Hickey, M; Bender, S; Ali, A; Nguyen, TT; Evnouchidou, I; Schilling, R; Stratikos, E; Golden, J; Stern, LJ Discovery of Selective Inhibitors of Endoplasmic Reticulum Aminopeptidase 1. J Med Chem 63: 103-121 (2020)
- Han, XR; Chen, L; Wei, Y; Yu, W; Chen, Y; Zhang, C; Jiao, B; Shi, T; Sun, L; Zhang, C; Xu, Y; Lee, MR; Luo, Y; Plewe, MB; Wang, J Discovery of Selective Small Molecule Degraders of BRAF-V600E. J Med Chem 63: 4069-4080 (2020)
- Chen, LH; Sun, B; Zhang, Y; Xu, TJ; Xia, ZX; Liu, JF; Nan, FJ Discovery of a Negative Allosteric Modulator of GABAB Receptors. ACS Med Chem Lett 5: 742-7 (2014)
- Huang, J; Zhang, J; Luo, B; Qiao, W; Qiu, Z; Song, R; Dai, Z; Sui, J; Xu, X; Ruan, S; Li, C; Luo, Y; Yang, T Discovery of a Novel Series of Imipridone Compounds as J Med Chem 65: 7629-7655 (2022)
- Zhao, Z; Pissarnitski, DA; Huang, X; Palani, A; Zhu, Z; Greenlee, WJ; Hyde, LA; Song, L; Terracina, G; Zhang, L; Parker, EM Discovery of a Tetrahydrobenzisoxazole Series of γ-Secretase Modulators. ACS Med Chem Lett 8: 1002-1006 (2017)
- Jones, P; Pryde, DC; Tran, TD; Adam, FM; Bish, G; Calo, F; Ciaramella, G; Dixon, R; Duckworth, J; Fox, DN; Hay, DA; Hitchin, J; Horscroft, N; Howard, M; Laxton, C; Parkinson, T; Parsons, G; Proctor, K; Smith, MC; Smith, N; Thomas, A Discovery of a highly potent series of TLR7 agonists. Bioorg Med Chem Lett 21: 5939-43 (2011)
- Mihalic, JT; Kim, YJ; Lizarzaburu, M; Chen, X; Deignan, J; Wanska, M; Yu, M; Fu, J; Chen, X; Zhang, A; Connors, R; Liang, L; Lindstrom, M; Ma, J; Tang, L; Dai, K; Li, L Discovery of a new class of ghrelin receptor antagonists. Bioorg Med Chem Lett 22: 2046-51 (2012)
- Koltun, E; Richards, S; Chan, V; Nachtigall, J; Du, H; Noson, K; Galan, A; Aay, N; Hanel, A; Harrison, A; Zhang, J; Won, KA; Tam, D; Qian, F; Wang, T; Finn, P; Ogilvie, K; Rosen, J; Mohan, R; Larson, C; Lamb, P; Nuss, J; Kearney, P Discovery of a new class of glucosylceramide synthase inhibitors. Bioorg Med Chem Lett 21: 6773-7 (2011)
- Dumas, J; Sibley, R; Riedl, B; Monahan, MK; Lee, W; Lowinger, TB; Redman, AM; Johnson, JS; Kingery-Wood, J; Scott, WJ; Smith, RA; Bobko, M; Schoenleber, R; Ranges, GE; Housley, TJ; Bhargava, A; Wilhelm, SM; Shrikhande, A Discovery of a new class of p38 kinase inhibitors. Bioorg Med Chem Lett 10: 2047-50 (2000)
- Shearer, BG; Patel, HS; Billin, AN; Way, JM; Winegar, DA; Lambert, MH; Xu, RX; Leesnitzer, LM; Merrihew, RV; Huet, S; Willson, TM Discovery of a novel class of PPARdelta partial agonists. Bioorg Med Chem Lett 18: 5018-22 (2008)
- Crosignani, S; Bombrun, A; Covini, D; Maio, M; Marin, D; Quattropani, A; Swinnen, D; Simpson, D; Sauer, W; Françon, B; Martin, T; Cambet, Y; Nichols, A; Martinou, I; Burgat-Charvillon, F; Rivron, D; Donini, C; Schott, O; Eligert, V; Novo-Perez, L; Vitte, PA; Arrighi, JF Discovery of a novel series of potent S1P1 agonists. Bioorg Med Chem Lett 20: 1516-9 (2010)
- McClure, KJ; Maher, M; Wu, N; Chaplan, SR; Eckert, WA; Lee, DH; Wickenden, AD; Hermann, M; Allison, B; Hawryluk, N; Breitenbucher, JG; Grice, CA Discovery of a novel series of selective HCN1 blockers. Bioorg Med Chem Lett 21: 5197-201 (2011)
- Perez, C; Li, J; Parlati, F; Rouffet, M; Ma, Y; Mackinnon, AL; Chou, TF; Deshaies, RJ; Cohen, SM Discovery of an Inhibitor of the Proteasome Subunit Rpn11. J Med Chem 60: 1343-1361 (2017)
- Kempson, J; Ovalle, D; Guo, J; Wrobleski, ST; Lin, S; Spergel, SH; Duan, JJ; Jiang, B; Lu, Z; Das, J; Yang, BV; Hynes, J; Wu, H; Tokarski, J; Sack, JS; Khan, J; Schieven, G; Blatt, Y; Chaudhry, C; Salter-Cid, LM; Fura, A; Barrish, JC; Carter, PH; Pitts, WJ Discovery of highly potent, selective, covalent inhibitors of JAK3. Bioorg Med Chem Lett 27: 4622-4625 (2017)
- Pandya, BA; Baber, C; Chan, A; Chamberlain, B; Chandonnet, H; Goss, J; Hopper, T; Lippa, B; Poutsiaka, K; Romero, J; Stucka, S; Varoglu, M; Zhang, J; Zhang, X Discovery of indole inhibitors of chemokine receptor 9 (CCR9). Bioorg Med Chem Lett 26: 3322-3325 (2016)
- Reverdy, C; Gitton, G; Guan, X; Adhya, I; Krishna Dumpati, R; Roy, S; Chall, S; Ghosh, A; Errasti, G; Delacroix, T; Chakrabarti, R Discovery of novel compounds as potent activators of Sirt3. Bioorg Med Chem 73: (2022)
- Lainé, D; Palovich, M; McCleland, B; Petitjean, E; Delhom, I; Xie, H; Deng, J; Lin, G; Davis, R; Jolit, A; Nevins, N; Zhao, B; Villa, J; Schneck, J; McDevitt, P; Midgett, R; Kmett, C; Umbrecht, S; Peck, B; Davis, AB; Bettoun, D Discovery of novel cyanamide-based inhibitors of cathepsin C. ACS Med Chem Lett 2: 142-147 (2011)
- Zhang, T; Inesta-Vaquera, F; Niepel, M; Zhang, J; Ficarro, SB; Machleidt, T; Xie, T; Marto, JA; Kim, N; Sim, T; Laughlin, JD; Park, H; LoGrasso, PV; Patricelli, M; Nomanbhoy, TK; Sorger, PK; Alessi, DR; Gray, NS Discovery of potent and selective covalent inhibitors of JNK. Chem Biol 19: 140-54 (2012)
- Fujii, N; Mallari, JP; Hansell, EJ; Mackey, Z; Doyle, P; Zhou, YM; Gut, J; Rosenthal, PJ; McKerrow, JH; Guy, RK Discovery of potent thiosemicarbazone inhibitors of rhodesain and cruzain. Bioorg Med Chem Lett 15: 121-3 (2004)
- Zhang, G; Wang, F; Li, S; Cheng, KW; Zhu, Y; Huo, R; Abdukirim, E; Kang, G; Chou, TF Discovery of small-molecule inhibitors of RUVBL1/2 ATPase. Bioorg Med Chem 62: (2022)
- Beshore, DC; Liverton, NJ; McIntyre, CJ; Claiborne, CF; Libby, B; Culberson, JC; Salata, JJ; Regan, CP; Lynch, JJ; Kiss, L; Spencer, RH; Kane, SA; White, RB; Yeh, S; Hartman, GD; Dinsmore, CJ Discovery of triarylethanolamine inhibitors of the Kv1.5 potassium channel. Bioorg Med Chem Lett 20: 2493-6 (2010)
- Peterson, EA; Andrews, PS; Be, X; Boezio, AA; Bush, TL; Cheng, AC; Coats, JR; Colletti, AE; Copeland, KW; DuPont, M; Graceffa, R; Grubinska, B; Harmange, JC; Kim, JL; Mullady, EL; Olivieri, P; Schenkel, LB; Stanton, MK; Teffera, Y; Whittington, DA; Cai, T; La, DS Discovery of triazine-benzimidazoles as selective inhibitors of mTOR. Bioorg Med Chem Lett 21: 2064-70 (2011)
- Mallari, JP; Shelat, A; Kosinski, A; Caffrey, CR; Connelly, M; Zhu, F; McKerrow, JH; Guy, RK Discovery of trypanocidal thiosemicarbazone inhibitors of rhodesain and TbcatB. Bioorg Med Chem Lett 18: 2883-5 (2008)
- Kim, Y; Kim, H; Lee, J; Lee, JK; Min, SJ; Seong, J; Rhim, H; Tae, J; Lee, HJ; Choo, H Discovery of β-Arrestin Biased Ligands of 5-HT J Med Chem 61: 7218-7233 (2018)
- Sharma, S; Lesiak, L; Aretz, CD; Du, Y; Kumar, S; Gautam, N; Alnouti, Y; Dhuria, NV; Chhonker, YS; Weaver, CD; Hopkins, CR Discovery, synthesis and biological characterization of a series of RSC Med Chem 12: 1366-1373 (2021)
- Sakai, R; Konno, K; Yamamoto, Y; Sanae, F; Takagi, K; Hasegawa, T; Iwasaki, N; Kakiuchi, M; Kato, H; Miyamoto, K Effects of alkyl substitutions of xanthine skeleton on bronchodilation. J Med Chem 35: 4039-44 (1992)
- Seo, WD; Ryu, YB; Curtis-Long, MJ; Lee, CW; Ryu, HW; Jang, KC; Park, KH Evaluation of anti-pigmentary effect of synthetic sulfonylamino chalcone. Eur J Med Chem 45: 2010-7 (2010)
- Rodriguez, CE; Holmes, HM; Mlodnosky, KL; Lam, VQ; Berkman, CE Evaluation of phosphorus-containing inhibitors of gamma-glutamyl hydrolase. Bioorg Med Chem Lett 8: 1521-4 (1999)
- FENWICK, A; WENZLER, ME; BILLEN, D; RAMTOHUL, YK; BROWN, W; VEMULA, N; MICHEL, NW; JOHNSON, T; SOLEY, J; SINCLAIR, GS; CHOO, KL; Maekawa, Y; AHMAD, T HETEROCYCLIC INHIBITORS OF IGF-1R FOR TREATMENT OF DISEASE US Patent US20250171431 (2025)
- Anderson, AC; Wright, DL; Frey, KM; Paulsen, JL; Scocchera, EW; Viswanathan, K Heterocyclic analogs of propargyl-linked inhibitors of dihydrofolate reductase US Patent US8853228 (2014)
- Ren, Z; Cabell, LA; Schaefer, TS; McMurray, JS Identification of a high-affinity phosphopeptide inhibitor of Stat3. Bioorg Med Chem Lett 13: 633-6 (2003)
- Qin, J; Xie, P; Ventocilla, C; Zhou, G; Vultur, A; Chen, Q; Liu, Q; Herlyn, M; Winkler, J; Marmorstein, R Identification of a novel family of BRAF(V600E) inhibitors. J Med Chem 55: 5220-30 (2012)
- Kraupner, N; Dinh, CP; Wen, X; Landry, V; Herledan, A; Leroux, F; Bosc, D; Charton, J; Maillard, C; Warenghem, S; Duplan, I; Piveteau, C; Hennuyer, N; Staels, B; Deprez, B; Deprez-Poulain, R Identification of indole-based activators of insulin degrading enzyme. Eur J Med Chem 228: (2022)
- Faridi, MH; Maiguel, D; Barth, CJ; Stoub, D; Day, R; Schürer, S; Gupta, V Identification of novel agonists of the integrin CD11b/CD18. Bioorg Med Chem Lett 19: 6902-6 (2009)
- Carini, DJ; Kaltenbach, RF; Liu, J; Benfield, PA; Boylan, J; Boisclair, M; Brizuela, L; Burton, CR; Cox, S; Grafstrom, R; Harrison, BA; Harrison, K; Akamike, E; Markwalder, JA; Nakano, Y; Seitz, SP; Sharp, DM; Trainor, GL; Sielecki, TM Identification of selective inhibitors of cyclin dependent kinase 4. Bioorg Med Chem Lett 11: 2209-11 (2001)
- Bakmiwewa, SM; Fatokun, AA; Tran, A; Payne, RJ; Hunt, NH; Ball, HJ Identification of selective inhibitors of indoleamine 2,3-dioxygenase 2. Bioorg Med Chem Lett 22: 7641-6 (2012)
- Heightman, TD; Conway, E; Corbett, DF; Macdonald, GJ; Stemp, G; Westaway, SM; Celestini, P; Gagliardi, S; Riccaboni, M; Ronzoni, S; Vaidya, K; Butler, S; McKay, F; Muir, A; Powney, B; Winborn, K; Wise, A; Jarvie, EM; Sanger, GJ Identification of small molecule agonists of the motilin receptor. Bioorg Med Chem Lett 18: 6423-8 (2008)
- Bacani, GM; Chai, W; Koudriakova, T; Krawczuk, PJ; Kreutter, KD; Leonard, K; Rizzolio, MC; Seierstad, M; Smith, RC; Tichenor, MS; Venable, JD; Wang, A Imidazopyrrolopyridine as inhibitors of the JAK family of kinases US Patent US10981911 (2021)
- Mucha, A; Lämmerhofer, M; Lindner, W; Pawelczak, M; Kafarski, P Individual stereoisomers of phosphinic dipeptide inhibitor of leucine aminopeptidase. Bioorg Med Chem Lett 18: 1550-4 (2008)
- Rosse, G Indolinone Inhibitors of ENT1 for the Treatment of Schizophrenia. ACS Med Chem Lett 8: 995-996 (2017)
- Abdel-Magid, AF Inhibitors of Mutant IDH for the Treatment of Cancer. ACS Med Chem Lett 5: 1184-5 (2014)
- Patel, S; Hamilton, G Inhibitors of RIP1 kinase and methods of use thereof US Patent US11072607 (2021)
- Arnold, LD; Jennings, A; Keung, W Inhibitors of cysteine proteases and methods of use thereof US Patent US11124497 (2021)
- Hammock, BD; Zheng, J; Morisseau, C; Motoba, K; Moghaddam, MF; Borhan, B; Grant, DF; Greene, J; Sisemore, MF; Sanborn, J Inhibitors of epoxide hydrolases for the treatment of inflammation US Patent US8815951 (2014)
- Copeland, RA; Richon, VM; Scott, MD; Sneeringer, CJ; Kuntz, KW; Knutson, SK; Pollock, RM Inhibitors of human EZH2 and methods of use thereof US Patent US8895245 (2014)
- Kuntz, KW; Knutson, SK; Wigle, TJ Inhibitors of human EZH2, and methods of use thereof US Patent US9175331 (2015)
- Cantley, L; Vander Heiden, MG; Christofk, HR Inhibitors of pyruvate kinase and methods of treating disease US Patent US8877791 (2014)
- Mastracchio, A; Lai, C; Torrent, M; Bromberg, K; Buchanan, FG; Ferguson, D; Bontcheva, V; Johnson, EF; Lasko, L; Maag, D; Shoemaker, AR; Penning, TD Investigation of biaryl heterocycles as inhibitors of Wee1 kinase. Bioorg Med Chem Lett 29: 1481-1486 (2019)
- Jayasuriya, H; Herath, KB; Ondeyka, JG; Polishook, JD; Bills, GF; Dombrowski, AW; Springer, MS; Siciliano, S; Malkowitz, L; Sanchez, M; Guan, Z; Tiwari, S; Stevenson, DW; Borris, RP; Singh, SB Isolation and structure of antagonists of chemokine receptor (CCR5). J Nat Prod 67: 1036-8 (2004)
- Pettinger, J; Carter, M; Jones, K; Cheeseman, MD Kinetic Optimization of Lysine-Targeting Covalent Inhibitors of HSP72. J Med Chem 62: 11383-11398 (2019)
- Perlikowska, R; Fichna, J; do-Rego, JC; Gach, K; Janecka, A Kinetic studies of novel inhibitors of endomorphin degrading enzymes. Med Chem Res 21: 1445-1450 (2012)
- Udompholkul, P; Baggio, C; Gambini, L; Alboreggia, G; Pellecchia, M Lysine Covalent Antagonists of Melanoma Inhibitors of Apoptosis Protein. J Med Chem 64: 16147-16158 (2021)
- MA, T; SHI, F; FANG, L; HUANG, Z; LIN, HV; XIAO, Y MODULATORS OF FPR1 AND METHODS OF USING THE SAME US Patent US20240018124 (2024)
- Holzgrabe, U; Brandt, W Mechanism of action of the diazabicyclononanone-type kappa-agonists. J Med Chem 46: 1383-9 (2003)
- Berlin, M; Dong, H; Sherman, D; Snyder, L; Wang, J; Zhang, W Modulators of BCL6 proteolysis and associated methods of use US Patent US12310975 (2025)
- Dementiev, A; Joachimiak, A; Nguyen, H; Gorelik, A; Illes, K; Shabani, S; Gelsomino, M; Ahn, EE; Nagar, B; Doan, N Molecular Mechanism of Inhibition of Acid Ceramidase by Carmofur. J Med Chem 62: 987-992 (2019)
- Tanaka, Y; Kurasawa, O; Yokota, A; Klein, MG; Saito, B; Matsumoto, S; Okaniwa, M; Ambrus-Aikelin, G; Uchiyama, N; Morishita, D; Kimura, H; Imamura, S New Series of Potent Allosteric Inhibitors of Deoxyhypusine Synthase. ACS Med Chem Lett 11: 1645-1652 (2020)
- Brnardic, EJ; Garbaccio, RM; Fraley, ME; Tasber, ES; Steen, JT; Arrington, KL; Dudkin, VY; Hartman, GD; Stirdivant, SM; Drakas, BA; Rickert, K; Walsh, ES; Hamilton, K; Buser, CA; Hardwick, J; Tao, W; Beck, SC; Mao, X; Lobell, RB; Sepp-Lorenzino, L; Yan, Y; Ikuta, M; Munshi, SK; Kuo, LC; Kreatsoulas, C Optimization of a pyrazoloquinolinone class of Chk1 kinase inhibitors. Bioorg Med Chem Lett 17: 5989-94 (2007)
- Marona, H; Szkaradek, N; Rapacz, A; Filipek, B; Dybala, M; Siwek, A; Cegla, M; Szneler, E Preliminary evaluation of pharmacological properties of some xanthone derivatives. Bioorg Med Chem 17: 1345-52 (2009)
- Currie, KS; Wang, X; Young, WB Pyridazinones, method of making, and method of use thereof US Patent US8975260 (2015)
- Mercader, AG; Duchowicz, PR; Fernández, FM; Castro, EA; Bennardi, DO; Autino, JC; Romanelli, GP QSAR prediction of inhibition of aldose reductase for flavonoids. Bioorg Med Chem 16: 7470-6 (2008)
- Pitts, WJ; Guo, J; Dhar, TG; Shen, Z; Gu, HH; Watterson, SH; Bednarz, MS; Chen, BC; Barrish, JC; Bassolino, D; Cheney, D; Fleener, CA; Rouleau, KA; Hollenbaugh, DL; Iwanowicz, EJ Rapid synthesis of triazine inhibitors of inosine monophosphate dehydrogenase. Bioorg Med Chem Lett 12: 2137-40 (2002)
- Welch, KT; Turner, TA; Preast, CE Rational design of novel glycomimetics: inhibitors of concanavalin A. Bioorg Med Chem Lett 18: 6573-5 (2008)
- Michalska, K; Karpiuk, I; Król, M; Tyski, S Recent development of potent analogues of oxazolidinone antibacterial agents. Bioorg Med Chem 21: 577-91 (2013)
- Yi, W; Dubois, C; Yahiaoui, S; Haudecoeur, R; Belle, C; Song, H; Hardré, R; Réglier, M; Boumendjel, A Refinement of arylthiosemicarbazone pharmacophore in inhibition of mushroom tyrosinase. Eur J Med Chem 46: 4330-5 (2011)
- Koudriakova, T; Kreutter, KD; Leonard, K; Rizzolio, MC; Smith, RC; Tichenor, MS; Wang, A Small molecule inhibitors of the JAK family of kinases US Patent US11059823 (2021)
- Bartholomeus, J; Bürli, R; Jarvis, R; Johnstone, S; Ostenfeld, T; Terstiege, I; Travagli, M; Turcotte, S Small molecule modulators of the BTB domain of Keap1 US Patent US11479539 (2022)
- Barber, AM; Hardcastle, IR; Rowlands, MG; Nutley, BP; Marriott, JH; Jarman, M Solid-phase synthesis of novel inhibitors of farnesyl transferase. Bioorg Med Chem Lett 9: 623-6 (1999)
- Katalinic, M; Rusak, G; Domacinovic Barovic, J; Sinko, G; Jelic, D; Antolovic, R; Kovarik, Z Structural aspects of flavonoids as inhibitors of human butyrylcholinesterase. Eur J Med Chem 45: 186-92 (2010)
- Hevener, KE; Yun, MK; Qi, J; Kerr, ID; Babaoglu, K; Hurdle, JG; Balakrishna, K; White, SW; Lee, RE Structural studies of pterin-based inhibitors of dihydropteroate synthase. J Med Chem 53: 166-77 (2010)
- Hernandez-Olmos, V; Knape, T; Heering, J; von Knethen, A; Kilu, W; Kaiser, A; Wurglics, M; Helmstädter, M; Merk, D; Schubert-Zsilavecz, M; Parnham, MJ; Steinhilber, D; Proschak, E Structure optimization of a new class of PPARγ antagonists. Bioorg Med Chem 27: (2019)
- Lu, J; Bart, AG; Wu, Q; Criscione, KR; McLeish, MJ; Scott, EE; Grunewald, GL Structure-Based Drug Design of Bisubstrate Inhibitors of Phenylethanolamine J Med Chem 63: 13878-13898 (2020)
- Yu, J; Ciancetta, A; Dudas, S; Duca, S; Lottermoser, J; Jacobson, KA Structure-Guided Modification of Heterocyclic Antagonists of the P2Y J Med Chem 61: 4860-4882 (2018)
- Koehler, MF; Bergeron, P; Choo, EF; Lau, K; Ndubaku, C; Dudley, D; Gibbons, P; Sleebs, BE; Rye, CS; Nikolakopoulos, G; Bui, C; Kulasegaram, S; Kersten, WJ; Smith, BJ; Czabotar, PE; Colman, PM; Huang, DC; Baell, JB; Watson, KG; Hasvold, L; Tao, ZF; Wang, L; Souers, AJ; Elmore, SW; Flygare, JA; Fairbrother, WJ; Lessene, G Structure-Guided Rescaffolding of Selective Antagonists of BCL-XL. ACS Med Chem Lett 5: 662-7 (2014)
- Rastelli, G; Tian, ZQ; Wang, Z; Myles, D; Liu, Y Structure-based design of 7-carbamate analogs of geldanamycin. Bioorg Med Chem Lett 15: 5016-21 (2005)
- Staben, ST; Siu, M; Goldsmith, R; Olivero, AG; Do, S; Burdick, DJ; Heffron, TP; Dotson, J; Sutherlin, DP; Zhu, BY; Tsui, V; Le, H; Lee, L; Lesnick, J; Lewis, C; Murray, JM; Nonomiya, J; Pang, J; Prior, WW; Salphati, L; Rouge, L; Sampath, D; Sideris, S; Wiesmann, C; Wu, P Structure-based design of thienobenzoxepin inhibitors of PI3-kinase. Bioorg Med Chem Lett 21: 4054-8 (2011)
- Feng, S; Xia, Y; Han, D; Zheng, C; He, X; Tang, X; Bai, D Synthesis and acetylcholinesterase inhibition of derivatives of huperzine B. Bioorg Med Chem Lett 15: 523-6 (2005)
- Brueggemeier, RW; Floyd, EE; Counsell, RE Synthesis and biochemical evaluation of inhibitors of estrogen biosynthesis. J Med Chem 21: 1007-11 (1979)
- Dolecková, I; Cesnek, M; Dracinský, M; Brynda, J; Voller, J; Janeba, Z; Kryštof, V Synthesis and biological evaluation of guanidino analogues of roscovitine. Eur J Med Chem 62: 443-52 (2013)
- Hackett, JC; Kim, YW; Su, B; Brueggemeier, RW Synthesis and characterization of azole isoflavone inhibitors of aromatase. Bioorg Med Chem 13: 4063-70 (2005)
- Silveira-Dorta, G; Sousa, IJ; Fernandes, MX; Martín, VS; Padrón, JM Synthesis and identification of unprecedented selective inhibitors of CK1e. Eur J Med Chem 96: 308-17 (2015)
- Meltzer-Mats, E; Babai-Shani, G; Pasternak, L; Uritsky, N; Getter, T; Viskind, O; Eckel, J; Cerasi, E; Senderowitz, H; Sasson, S; Gruzman, A Synthesis and mechanism of hypoglycemic activity of benzothiazole derivatives. J Med Chem 56: 5335-50 (2014)
- Cebula, RE; Blanchard, JL; Boisclair, MD; Pal, K; Bockovich, NJ Synthesis and phosphatase inhibitory activity of analogs of sulfircin Bioorg Med Chem Lett 7: 2015-2020 (1997)
- Davidsen, SK; Summers, JB; Sweeny, DJ; Holms, JH; Albert, DH; Carrera, GM; Tapang, P; Magoc, TJ; Conway, RG; Rhein, DA Synthesis of active metabolites of indole pyrrolothiazole paf antagonists Bioorg Med Chem Lett 5: 2909-2912 (1995)
- Hanessian, S; Griffin, A; Devasthale, PV Synthesis of conformationally constrained potential inhibitors of mammalian metalloproteinases Bioorg Med Chem Lett 7: 3119-3124 (1997)
- Huang, W; Li, J; Zhang, W; Zhou, Y; Xie, C; Luo, Y; Li, Y; Wang, J; Li, J; Lu, W Synthesis of miltirone analogues as inhibitors of Cdc25 phosphatases. Bioorg Med Chem Lett 16: 1905-8 (2006)
- Augustyns, K; Borloo, M; Belyaev, A; Rajan, P; Goossens, F; Hendriks, D; Scharpé, S; Haemers, A Synthesis of peptidyl acetals as inhibitors of prolyl endopeptidase Bioorg Med Chem Lett 5: 1265-1270 (1995)
- Hughes, I; Harper, GP; Karran, EH; Markwell, RE; Miles-Williams, AJ Synthesis of thiophenol derivatives as inhibitors of human collagenase Bioorg Med Chem Lett 5: 3039-3042 (1995)
- Kuang, R; Wu, H; Ting, PC; Aslanian, RG; Cao, J; Kim, DW; Lee, JF; Schwerdt, J; Zhou, G; Herr, RJ; Zych, AJ; Yang, J; Lam, SQ; Jenkins, DM; Sakwa, SA; Wainhaus, S; Black, TA; Cacciapuoti, A; McNicholas, PM; Xu, Y; Walker, SS The optimization of pyridazinone series of glucan synthase inhibitors. Bioorg Med Chem Lett 22: 5268-71 (2012)
- Wisniewski, K; Trojnar, J; Riviere, P; Haigh, R; Yea, C; Ashworth, D; Melin, P; Nilsson, A The synthesis of a new class of oxytocin antagonists. Bioorg Med Chem Lett 9: 2801-4 (1999)
- Ratilainen, T; Holmén, A; Tuite, E; Nielsen, PE; Nordén, B Thermodynamics of sequence-specific binding of PNA to DNA. Biochemistry 39: 7781-91 (2000)
- Kargbo, RB Treatment of Cancers by Inhibition of Isoprenylcysteine Carboxyl Methyltransferase. ACS Med Chem Lett 10: 1024-1025 (2019)
- PubChem, PC uHTS HTRF assay for identification of inhibitors of SUMOylation PubChem Bioassay (2010)
- Harvey, AJ; Baell, JB; Toovey, N; Homerick, D; Wulff, H A new class of blockers of the voltage-gated potassium channel Kv1.3 via modification of the 4- or 7-position of khellinone. J Med Chem 49: 1433-41 (2006)
- MORISSET-LOPEZ, S; SUZENET, F; GUILLAUMET, G; DEAU, E; ROBIN, E; EL KHAMLICHI, C; REVERCHON-ASSADI, F; HERVOUET-COSTE, N; MADOURI, F; HIEBEL, M; LE-BESCONT, J APPLICATIONS OF BIASED LIGANDS OF THE SEROTONIN 5-HT7 RECEPTOR FOR THE TREATMENT OF PAIN, MULTIPLE SCLEROSIS AND THE CONTROL OF THERMOREGULATION US Patent US20240199555 (2024)
- Sureshan, KM; Riley, AM; Thomas, MP; Tovey, SC; Taylor, CW; Potter, BV Contribution of phosphates and adenine to the potency of adenophostins at the IP3 receptor: synthesis of all possible bisphosphates of adenophostin A. J Med Chem 55: 1706-20 (2012)
- Futatsugi, K; Smith, AC; Tu, M; Raymer, B; Ahn, K; Coffey, SB; Dowling, MS; Fernando, DP; Gutierrez, JA; Huard, K; Jasti, J; Kalgutkar, AS; Knafels, JD; Pandit, J; Parris, KD; Perez, S; Pfefferkorn, JA; Price, DA; Ryder, T; Shavnya, A; Stock, IA; Tsai, AS; Tesz, GJ; Thuma, BA; Weng, Y; Wisniewska, HM; Xing, G; Zhou, J; Magee, TV Discovery of PF-06835919: A Potent Inhibitor of Ketohexokinase (KHK) for the Treatment of Metabolic Disorders Driven by the Overconsumption of Fructose. J Med Chem 63: 13546-13560 (2020)
- Takeuchi, CS; Kim, BG; Blazey, CM; Ma, S; Johnson, HW; Anand, NK; Arcalas, A; Baik, TG; Buhr, CA; Cannoy, J; Epshteyn, S; Joshi, A; Lara, K; Lee, MS; Wang, L; Leahy, JW; Nuss, JM; Aay, N; Aoyama, R; Foster, P; Lee, J; Lehoux, I; Munagala, N; Plonowski, A; Rajan, S; Woolfrey, J; Yamaguchi, K; Lamb, P; Miller, N Discovery of a novel class of highly potent, selective, ATP-competitive, and orally bioavailable inhibitors of the mammalian target of rapamycin (mTOR). J Med Chem 56: 2218-34 (2013)
- Markovich, KM; Farooqui, T; Wallace, LJ; Uretsky, NJ; Miller, DD Enhancement of binding of quaternary ammonium derivatives of chlorpromaxine to dopamine D-2 receptors by the addition of a H-bonding group Bioorg Med Chem Lett 3: 1241-1244 (1993)
- Guillerm, G; Guillerm, D; Vandenplas-Witkowki, C; Rogniaux, H; Carte, N; Leize, E; Van Dorsselaer, A; De Clercq, E; Lambert, C Synthesis, mechanism of action, and antiviral activity of a new series of covalent mechanism-based inhibitors of S-adenosyl-L-homocysteine hydrolase. J Med Chem 44: 2743-52 (2001)
- Dini, C; Drochon, N; Feteanu, S; Guillot, JC; Peixoto, C; Aszodi, J Synthesis of analogues of the O-beta-D-ribofuranosyl nucleoside moiety of liposidomycins. Part 1: contribution of the amino group and the uracil moiety upon the inhibition of MraY. Bioorg Med Chem Lett 11: 529-31 (2001)
- Dhar, TG; Liu, C; Pitts, WJ; Guo, J; Watterson, SH; Gu, H; Fleener, CA; Rouleau, K; Sherbina, NZ; Barrish, JC; Hollenbaugh, D; Iwanowicz, EJ A survey of cyclic replacements for the central diamide moiety of inhibitors of inosine monophosphate dehydrogenase. Bioorg Med Chem Lett 12: 3125-8 (2002)
- Wong, DT; Threlkeld, PG; Robertson, DW Affinities of fluoxetine, its enantiomers, and other inhibitors of serotonin uptake for subtypes of serotonin receptors. Neuropsychopharmacology 5: 43-7 (1991)
- Argade, MD; Mehta, AY; Sarkar, A; Desai, UR Allosteric inhibition of human factor XIa: discovery of monosulfated benzofurans as a class of promising inhibitors. J Med Chem 57: 3559-69 (2014)
- Jung, M; Brosch, G; Kölle, D; Scherf, H; Gerhäuser, C; Loidl, P Amide analogues of trichostatin A as inhibitors of histone deacetylase and inducers of terminal cell differentiation. J Med Chem 42: 4669-79 (1999)
- Altenkämper, M; Bechem, B; Perruchon, J; Heinrich, S; Mädel, A; Ortmann, R; Dahse, HM; Freunscht, E; Wang, Y; Rath, J; Stich, A; Hitzler, M; Chiba, P; Lanzer, M; Schlitzer, M Antimalarial and antitrypanosomal activity of a series of amide and sulfonamide derivatives of a 2,5-diaminobenzophenone. Bioorg Med Chem 17: 7690-7 (2009)
- de Koning, MC; Joosen, MJA; Worek, F; Nachon, F; van Grol, M; Klaassen, SD; Alkema, DPW; Wille, T; de Bruijn, HM Application of the Ugi Multicomponent Reaction in the Synthesis of Reactivators of Nerve Agent Inhibited Acetylcholinesterase. J Med Chem 60: 9376-9392 (2017)
- Ji, S; Li, Z; Song, W; Wang, Y; Liang, W; Li, K; Tang, S; Wang, Q; Qiao, X; Zhou, D; Yu, S; Ye, M Bioactive Constituents of Glycyrrhiza uralensis (Licorice): Discovery of the Effective Components of a Traditional Herbal Medicine. J Nat Prod 79: 281-92 (2016)
- Grasso, S; Micale, N; Zappalà, M; Galli, A; Costagli, C; Menniti, FS; De Micheli, C Characterization of the mechanism of anticonvulsant activity for a selected set of putative AMPA receptor antagonists. Bioorg Med Chem Lett 13: 443-6 (2003)
- Hanessian, S; Sgarbi, PW Design and synthesis of mimics of S-adenosyl-L-homocysteine as potential inhibitors of erythromycin methyltransferases. Bioorg Med Chem Lett 10: 433-7 (2000)
- Zhang, L; Zhang, Y; Dong, J; Liu, J; Zhang, L; Sun, H Design and synthesis of novel photoaffinity probes for study of the target proteins of oleanolic acid. Bioorg Med Chem Lett 22: 1036-9 (2012)
- Jones, ED; Vandegraaff, N; Le, G; Choi, N; Issa, W; Macfarlane, K; Thienthong, N; Winfield, LJ; Coates, JA; Lu, L; Li, X; Feng, X; Yu, C; Rhodes, DI; Deadman, JJ Design of a series of bicyclic HIV-1 integrase inhibitors. Part 1: selection of the scaffold. Bioorg Med Chem Lett 20: 5913-7 (2010)
- Phillips, G; Guilford, WJ; Buckman, BO; Davey, DD; Eagen, KA; Koovakkat, S; Liang, A; McCarrick, M; Mohan, R; Ng, HP; Pinkerton, M; Subramanyam, B; Ho, E; Trinh, L; Whitlow, M; Wu, S; Xu, W; Morrissey, MM Design, synthesis, and activity of a novel series of factor Xa inhibitors: optimization of arylamidine groups. J Med Chem 45: 2484-93 (2002)
- Lyles-Eggleston, M; Altundas, R; Xia, J; Sikazwe, DM; Fan, P; Yang, Q; Li, S; Zhang, W; Zhu, X; Schmidt, AW; Vanase-Frawley, M; Shrihkande, A; Villalobos, A; Borne, RF; Ablordeppey, SY Design, synthesis, and evaluation of metabolism-based analogues of haloperidol incapable of forming MPP+-like species. J Med Chem 47: 497-508 (2004)
- Dai, Z; Chen, XY; An, LY; Li, CC; Zhao, N; Yang, F; You, ST; Hou, CZ; Li, K; Jiang, C; You, QD; Di, B; Xu, LL Development of Novel Tetrahydroquinoline Inhibitors of NLRP3 Inflammasome for Potential Treatment of DSS-Induced Mouse Colitis. J Med Chem 64: 871-889 (2021)
- Yang, K; Li, S; Wang, T; Yan, X; He, Q; Ning, R; Xu, X; Yao, W; Zhang, X; Yang, C; Jiang, M; Deng, L Development of an Orally Active Small-Molecule Inhibitor of Receptor Activator of Nuclear Factor-κB Ligand. J Med Chem 65: 10992-11009 (2022)
- Rafferty, MF; Borchardt, RT; Grunewald, GL Directional probes of the hydrophobic component of the aromatic ring binding site of norepinephrine N-methyltransferase. J Med Chem 25: 1204-8 (1983)
- Hall, A; Abendroth, J; Bolejack, MJ; Ceska, T; Dell'Aiera, S; Ellis, V; Fox, D; François, C; Muruthi, MM; Prével, C; Poullennec, K; Romanov, S; Valade, A; Vanbellinghen, A; Yano, J; Geraerts, M Discovery and Characterization of a Novel Series of Chloropyrimidines as Covalent Inhibitors of the Kinase MSK1. ACS Med Chem Lett 13: 1099-1108 (2022)
- Duffy, JL; Kirk, BA; Konteatis, Z; Campbell, EL; Liang, R; Brady, EJ; Candelore, MR; Ding, VD; Jiang, G; Liu, F; Qureshi, SA; Saperstein, R; Szalkowski, D; Tong, S; Tota, LM; Xie, D; Yang, X; Zafian, P; Zheng, S; Chapman, KT; Zhang, BB; Tata, JR Discovery and investigation of a novel class of thiophene-derived antagonists of the human glucagon receptor. Bioorg Med Chem Lett 15: 1401-5 (2005)
- Hornberger, KR; Chen, X; Crew, AP; Kleinberg, A; Ma, L; Mulvihill, MJ; Wang, J; Wilde, VL; Albertella, M; Bittner, M; Cooke, A; Kadhim, S; Kahler, J; Maresca, P; May, E; Meyn, P; Romashko, D; Tokar, B; Turton, R Discovery of 7-aminofuro[2,3-c]pyridine inhibitors of TAK1: optimization of kinase selectivity and pharmacokinetics. Bioorg Med Chem Lett 23: 4511-6 (2013)
- Scanio, MJC; Searle, XB; Liu, B; Koenig, JR; Altenbach, R; Gfesser, GA; Bogdan, A; Greszler, S; Zhao, G; Singh, A; Fan, Y; Swensen, AM; Vortherms, T; Manelli, A; Balut, C; Jia, Y; Gao, W; Yong, H; Schrimpf, M; Tse, C; Kym, P; Wang, X Discovery of ABBV/GLPG-3221, a Potent Corrector of CFTR for the Treatment of Cystic Fibrosis. ACS Med Chem Lett 10: 1543-1548 (2019)
- Boerth, JA; Chinn, AJ; Schimpl, M; Bommakanti, G; Chan, C; Code, EL; Giblin, KA; Gohlke, A; Hansel, CS; Jin, M; Kavanagh, SL; Lamb, ML; Lane, JS; Larner, CJB; Mfuh, AM; Moore, RK; Puri, T; Quinn, TR; Ye, M; Robbins, KJ; Gancedo-Rodrigo, M; Tang, H; Walsh, J; Ware, J; Wrigley, GL; Reddy, IK; Zhang, Y; Grimster, NP Discovery of a Novel Benzodiazepine Series of Cbl-b Inhibitors for the Enhancement of Antitumor Immunity. ACS Med Chem Lett 14: 1848-1856 (2023)
- Li, J; Chen, L; Billedeau, RJ; Stanton, TF; Chiang, JTP; Lee, CC; Li, W; Steggerda, S; Emberley, E; Gross, M; Bhupathi, D; Che, X; Chen, J; Dang, R; Huang, T; Ma, Y; MacKinnon, A; Makkouk, A; Marguier, G; Neou, S; Sotirovska, N; Spurlock, S; Zhang, J; Zhang, W; van Zandt, M; Yuan, L; Savoy, J; Parlati, F; Sjogren, EB Discovery of a Series of Potent, Selective, and Orally Bioavailable Nucleoside Inhibitors of CD73 That Demonstrates J Med Chem 66: 345-370 (2023)
- Harcken, C; Csengery, J; Turner, M; Wu, L; Liang, S; Sibley, R; Brunette, S; Labadia, M; Hoyt, K; Wayne, A; Wieckowski, T; Davis, G; Panzenbeck, M; Souza, D; Kugler, S; Terenzio, D; Collin, D; Smith, D; Fryer, RM; Tseng, YC; Hehn, JP; Fletcher, K; Hughes, RO Discovery of a Series of Pyrazinone RORγ Antagonists and Identification of the Clinical Candidate BI 730357. ACS Med Chem Lett 12: 143-154 (2021)
- Tyagarajan, S; Chakravarty, PK; Zhou, B; Taylor, B; Eid, R; Fisher, MH; Parsons, WH; Wyvratt, MJ; Lyons, KA; Klatt, T; Li, X; Kumar, S; Williams, B; Felix, J; Priest, BT; Brochu, RM; Warren, V; Smith, M; Garcia, M; Kaczorowski, GJ; Martin, WJ; Abbadie, C; McGowan, E; Jochnowitz, N; Weber, A; Duffy, JL Discovery of a novel class of biphenyl pyrazole sodium channel blockers for treatment of neuropathic pain. Bioorg Med Chem Lett 20: 7479-82 (2010)
- Rao, AU; Shao, N; Aslanian, RG; Chan, TY; Degrado, SJ; Wang, L; McKittrick, B; Senior, M; West, RE; Williams, SM; Wu, RL; Hwa, J; Patel, B; Zheng, S; Sondey, C; Palani, A Discovery of a potent thiadiazole class of histamine h3 receptor antagonist for the treatment of diabetes. ACS Med Chem Lett 3: 198-202 (2012)
- Hauck, D; Joachim, I; Frommeyer, B; Varrot, A; Philipp, B; Möller, HM; Möller, A; Exner, TE; Titz, A Discovery of two classes of potent glycomimetic inhibitors of Pseudomonas aeruginosa LecB with distinct binding modes. ACS Chem Biol 8: 1775-84 (2013)
- PubChem, PC Dose response confirmation of the uHTS fluorescent assay for identification of inhibitors of ATG4B Set 2 PubChem Bioassay (2011)
- Giannangeli, M; Cazzolla, N; Luparini, MR; Magnani, M; Mabilia, M; Picconi, G; Tomaselli, M; Baiocchi, L Effect of modifications of the alkylpiperazine moiety of trazodone on 5HT2A and alpha1 receptor binding affinity. J Med Chem 42: 336-45 (1999)
- Park, JS; Chang, CT; Mertes, MP Enzyme affinity of the 5,6-dihydro derivatives of the substrate and product of thymidylate synthetase catalysis. J Med Chem 22: 319-21 (1979)
- Riendeau, D; Salem, M; Styhler, A; Ouellet, M; Mancini, JA; Li, CS Evaluation of loxoprofen and its alcohol metabolites for potency and selectivity of inhibition of cyclooxygenase-2. Bioorg Med Chem Lett 14: 1201-3 (2004)
- Li, C; Zhan, C; Zhao, L; Chen, X; Lu, WY; Lu, W Functional consequences of retro-inverso isomerization of a miniature protein inhibitor of the p53-MDM2 interaction. Bioorg Med Chem 21: 4045-50 (2013)
- Morwick, T; Büttner, FH; Cywin, CL; Dahmann, G; Hickey, E; Jakes, S; Kaplita, P; Kashem, MA; Kerr, S; Kugler, S; Mao, W; Marshall, D; Paw, Z; Shih, CK; Wu, F; Young, E Hit to lead account of the discovery of bisbenzamide and related ureidobenzamide inhibitors of Rho kinase. J Med Chem 53: 759-77 (2010)
- Bata, I; Tömösközi, Z; Buzder-Lantos, P; Vasas, A; Szeleczky, G; Bátori, S; Barta-Bodor, V; Balázs, L; Ferenczy, GG I. Discovery of a novel series of CXCR3 antagonists. Multiparametric optimization of N,N-disubstituted benzylamines. Bioorg Med Chem Lett 26: 5418-5428 (2016)
- MacLeod, AM; Mitchell, DR; Palmer, NJ; Van de Poël, H; Conrath, K; Andrews, M; Leyssen, P; Neyts, J Identification of a series of compounds with potent antiviral activity for the treatment of enterovirus infections. ACS Med Chem Lett 4: 585-9 (2013)
- Jarvest, RL; Berge, JM; Houge-Frydrych, CS; Mensah, LM; O'Hanlon, PJ; Pope, AJ Inhibitors of bacterial tyrosyl tRNA synthetase: synthesis of carbocyclic analogues of the natural product SB-219383. Bioorg Med Chem Lett 11: 2499-502 (2001)
- Chauvel, EN; Coric, P; Llorens-Cortès, C; Wilk, S; Roques, BP; Fournié-Zaluski, MC Investigation of the active site of aminopeptidase A using a series of new thiol-containing inhibitors. J Med Chem 37: 1339-46 (1994)
- Kempf, DJ; Molla, A; Marsh, KC; Park, C; Rodrigues, AD; Korneyeva, M; Vasavanonda, S; McDonald, E; Flentge, CA; Muchmore, S; Wideburg, NE; Saldivar, A; Cooper, A; Kati, WM; Stewart, KD; Norbeck, DW Lack of stereospecificity in the binding of the P2 amino acid of ritonavir to HIV protease Bioorg Med Chem Lett 7: 699-704 (1997)
- Göransson, O; McBride, A; Hawley, SA; Ross, FA; Shpiro, N; Foretz, M; Viollet, B; Hardie, DG; Sakamoto, K Mechanism of action of A-769662, a valuable tool for activation of AMP-activated protein kinase. J Biol Chem 282: 32549-60 (2007)
- Gazzard, L; Williams, K; Chen, H; Axford, L; Blackwood, E; Burton, B; Chapman, K; Crackett, P; Drobnick, J; Ellwood, C; Epler, J; Flagella, M; Gancia, E; Gill, M; Goodacre, S; Halladay, J; Hewitt, J; Hunt, H; Kintz, S; Lyssikatos, J; Macleod, C; Major, S; Médard, G; Narukulla, R; Ramiscal, J; Schmidt, S; Seward, E; Wiesmann, C; Wu, P; Yee, S; Yen, I; Malek, S Mitigation of Acetylcholine Esterase Activity in the 1,7-Diazacarbazole Series of Inhibitors of Checkpoint Kinase 1. J Med Chem 58: 5053-74 (2015)
- Scott, DA; Dakin, LA; Daly, K; Del Valle, DJ; Diebold, RB; Drew, L; Ezhuthachan, J; Gero, TW; Ogoe, CA; Omer, CA; Redmond, SP; Repik, G; Thakur, K; Ye, Q; Zheng, X Mitigation of cardiovascular toxicity in a series of CSF-1R inhibitors, and the identification of AZD7507. Bioorg Med Chem Lett 23: 4591-6 (2013)
- Hyttel, J; Larsen, JJ Neurochemical profile of Lu 19-005, a potent inhibitor of uptake of dopamine, noradrenaline, and serotonin. J Neurochem 44: 1615-22 (1985)
- Jakob, CG; Upadhyay, AK; Donner, PL; Nicholl, E; Addo, SN; Qiu, W; Ling, C; Gopalakrishnan, SM; Torrent, M; Cepa, SP; Shanley, J; Shoemaker, AR; Sun, CC; Vasudevan, A; Woller, KR; Shotwell, JB; Shaw, B; Bian, Z; Hutti, JE Novel Modes of Inhibition of Wild-Type Isocitrate Dehydrogenase 1 (IDH1): Direct Covalent Modification of His315. J Med Chem 61: 6647-6657 (2018)
- Chapman, TM; Osborne, SA; Wallace, C; Birchall, K; Bouloc, N; Jones, HM; Ansell, KH; Taylor, DL; Clough, B; Green, JL; Holder, AA Optimization of an imidazopyridazine series of inhibitors of Plasmodium falciparum calcium-dependent protein kinase 1 (PfCDPK1). J Med Chem 57: 3570-87 (2014)
- Roussel, E; Tran-Nguyen, VK; Bouhedjar, K; Dems, MA; Belaidi, A; Matougui, B; Peres, B; Azioune, A; Renaudet, O; Falson, P; Boumendjel, A Optimization of the chromone scaffold through QSAR and docking studies: Identification of potent inhibitors of ABCG2. Eur J Med Chem 184: (2019)
- Buchholz, S; Schally, AV; Engel, JB; Hohla, F; Heinrich, E; Koester, F; Varga, JL; Halmos, G Potentiation of mammary cancer inhibition by combination of antagonists of growth hormone-releasing hormone with docetaxel. Proc Natl Acad Sci U S A 104: 1943-6 (2007)
- Szardenings, AK; Harris, D; Lam, S; Shi, L; Tien, D; Wang, Y; Patel, DV; Navre, M; Campbell, DA Rational design and combinatorial evaluation of enzyme inhibitor scaffolds: identification of novel inhibitors of matrix metalloproteinases. J Med Chem 41: 2194-200 (1998)
- Araújo, JQ; de Brito, MA; Hoelz, LV; de Alencastro, RB; Castro, HC; Rodrigues, CR; Albuquerque, MG Receptor-dependent (RD) 3D-QSAR approach of a series of benzylpiperidine inhibitors of human acetylcholinesterase (HuAChE). Eur J Med Chem 46: 39-51 (2010)
- PubChem, PC SAR analysis of Antagonists of XIAP-Bir3 domain of IAP-family anti-apoptotic proteins - Set 2 PubChem Bioassay (2010)
- Powers, JP; Piper, DE; Li, Y; Mayorga, V; Anzola, J; Chen, JM; Jaen, JC; Lee, G; Liu, J; Peterson, MG; Tonn, GR; Ye, Q; Walker, NP; Wang, Z SAR and mode of action of novel non-nucleoside inhibitors of hepatitis C NS5b RNA polymerase. J Med Chem 49: 1034-46 (2006)
- Petukhov, PA; Zhang, J; Kozikowski, AP; Wang, CZ; Ye, YP; Johnson, KM; Tella, SR SAR studies of piperidine-based analogues of cocaine. 4. Effect of N-modification and ester replacement. J Med Chem 45: 3161-70 (2002)
- Pendri, A; Dodd, DS; Chen, J; Cvijic, ME; Kang, L; Baska, RA; Carlson, KE; Burford, NT; Sun, C; Ewing, WR; Gerritz, SW Solid phase synthesis of 1,5-diarylpyrazole-4-carboxamides: discovery of antagonists of the CB-1 receptor. ACS Comb Sci 14: 197-204 (2012)
- König, M; Müller, C; Bracher, F Stereoselective synthesis of a new class of potent and selective inhibitors of human¿8,7-sterol isomerase. Bioorg Med Chem 21: 1925-43 (2013)
- Trân, K; Murza, A; Sainsily, X; Delile, E; Couvineau, P; Côté, J; Coquerel, D; Peloquin, M; Auger-Messier, M; Bouvier, M; Lesur, O; Sarret, P; Marsault, É Structure-Activity Relationship and Bioactivity of Short Analogues of ELABELA as Agonists of the Apelin Receptor. J Med Chem 64: 602-615 (2021)
- Montgomery, JA; Niwas, S; Rose, JD; Secrist, JA; Babu, YS; Bugg, CE; Erion, MD; Guida, WC; Ealick, SE Structure-based design of inhibitors of purine nucleoside phosphorylase. 1. 9-(arylmethyl) derivatives of 9-deazaguanine. J Med Chem 36: 55-69 (1993)
- Jarvest, RL; Breen, AL; Edge, CM; Chaikin, MA; Jennings, LJ; Truneh, A; Sweet, RW; Hertzberg, RP Structure-directed discovery of an inhibitor of the binding of HIV GP120 to the CD4 receptor Bioorg Med Chem Lett 3: 2851-2856 (1993)
- Bolívar, BE; Welch, JT Studies of the Binding of Modest Modulators of the Human Enzyme, Sirtuin 6, by STD NMR. Chembiochem 18: 931-940 (2017)
- Le Brazidec, JY; Kamal, A; Busch, D; Thao, L; Zhang, L; Timony, G; Grecko, R; Trent, K; Lough, R; Salazar, T; Khan, S; Burrows, F; Boehm, MF Synthesis and biological evaluation of a new class of geldanamycin derivatives as potent inhibitors of Hsp90. J Med Chem 47: 3865-73 (2004)
- Grunewald, GL; Sall, DJ; Monn, JA Synthesis and evaluation of 3-substituted analogues of 1,2,3,4-tetrahydroisoquinoline as inhibitors of phenylethanolamine N-methyltransferase. J Med Chem 31: 824-30 (1988)
- Zheng, G; Dwoskin, LP; Deaciuc, AG; Crooks, PA Synthesis and evaluation of a series of homologues of lobelane at the vesicular monoamine transporter-2. Bioorg Med Chem Lett 18: 6509-12 (2008)
- Folkes, A; Roe, MB; Sohal, S; Golec, J; Faint, R; Brooks, T; Charlton, P Synthesis and in vitro evaluation of a series of diketopiperazine inhibitors of plasminogen activator inhibitor-1. Bioorg Med Chem Lett 11: 2589-92 (2001)
- Mu, F; Lee, DJ; Pryor, DE; Hamel, E; Cushman, M Synthesis and investigation of conformationally restricted analogues of lavendustin A as cytotoxic inhibitors of tubulin polymerization. J Med Chem 45: 4774-85 (2002)
- Liao, Y; DeBoer, P; Meier, E; Wikström, H Synthesis and pharmacological evaluation of triflate-substituted analogues of clozapine: identification of a novel atypical neuroleptic. J Med Chem 40: 4146-53 (1998)
- Caldarelli, M; Habermann, J; Ley, SV Synthesis of an array of potential matrix metalloproteinase inhibitors using a sequence of polymer-supported reagents. Bioorg Med Chem Lett 9: 2049-52 (1999)
- Najda-Bernatowicz, A; Łebska, M; Orzeszko, A; Kopanska, K; Krzywinska, E; Muszynska, G; Bretner, M Synthesis of new analogs of benzotriazole, benzimidazole and phthalimide--potential inhibitors of human protein kinase CK2. Bioorg Med Chem 17: 1573-8 (2009)
- Blass, BE Tricyclic Inhibitors of β-Secretase and Their Methods of Use for the Treatment of Alzheimer's Disease. ACS Med Chem Lett 10: 8-9 (2019)
- Nomme, J; Renodon-Cornière, A; Asanomi, Y; Sakaguchi, K; Stasiak, AZ; Stasiak, A; Norden, B; Tran, V; Takahashi, M Design of potent inhibitors of human RAD51 recombinase based on BRC motifs of BRCA2 protein: modeling and experimental validation of a chimera peptide. J Med Chem 53: 5782-91 (2010)
- Qunies, AM; Spitznagel, BD; Du, Y; David Weaver, C; Emmitte, KA Design, synthesis, and biological evaluation of a novel series of 1,2,4-oxadiazole inhibitors of SLACK potassium channels: Identification of in vitro tool VU0935685. Bioorg Med Chem 95: (2023)
- Liu, Y; Shang, L; Fang, H; Zhu, H; Mu, J; Wang, Q; Wang, X; Yuan, Y; Xu, W Design, synthesis, and preliminary studies of the activity of novel derivatives of N-cinnamoyl-L-aspartic acid as inhibitors of aminopeptidase N/CD13. Bioorg Med Chem 17: 7398-404 (2009)
- Barlaam, B; Casella, R; Cidado, J; Cook, C; De Savi, C; Dishington, A; Donald, CS; Drew, L; Ferguson, AD; Ferguson, D; Glossop, S; Grebe, T; Gu, C; Hande, S; Hawkins, J; Hird, AW; Holmes, J; Horstick, J; Jiang, Y; Lamb, ML; McGuire, TM; Moore, JE; O'Connell, N; Pike, A; Pike, KG; Proia, T; Roberts, B; San Martin, M; Sarkar, U; Shao, W; Stead, D; Sumner, N; Thakur, K; Vasbinder, MM; Varnes, JG; Wang, J; Wang, L; Wu, D; Wu, L; Yang, B; Yao, T Discovery of AZD4573, a Potent and Selective Inhibitor of CDK9 That Enables Short Duration of Target Engagement for the Treatment of Hematological Malignancies. J Med Chem 63: 15564-15590 (2020)
- Flygare, JA; Beresini, M; Budha, N; Chan, H; Chan, IT; Cheeti, S; Cohen, F; Deshayes, K; Doerner, K; Eckhardt, SG; Elliott, LO; Feng, B; Franklin, MC; Reisner, SF; Gazzard, L; Halladay, J; Hymowitz, SG; La, H; LoRusso, P; Maurer, B; Murray, L; Plise, E; Quan, C; Stephan, JP; Young, SG; Tom, J; Tsui, V; Um, J; Varfolomeev, E; Vucic, D; Wagner, AJ; Wallweber, HJ; Wang, L; Ware, J; Wen, Z; Wong, H; Wong, JM; Wong, M; Wong, S; Yu, R; Zobel, K; Fairbrother, WJ Discovery of a potent small-molecule antagonist of inhibitor of apoptosis (IAP) proteins and clinical candidate for the treatment of cancer (GDC-0152). J Med Chem 55: 4101-13 (2012)
- Petrelli, R; Meli, M; Vita, P; Torquati, I; Ferro, A; Vodnala, M; D'Alessandro, N; Tolomeo, M; Del Bello, F; Kusumanchi, P; Franchetti, P; Grifantini, M; Jayaram, HN; Hofer, A; Cappellacci, L From the covalent linkage of drugs to novel inhibitors of ribonucleotide reductase: synthesis and biological evaluation of valproic esters of 3'-C-methyladenosine. Bioorg Med Chem Lett 24: 5304-9 (2014)
- Boschelli, DH; Ye, F; Wu, B; Wang, YD; Barrios Sosa, AC; Yaczko, D; Powell, D; Golas, JM; Lucas, J; Boschelli, F Investigation of the effect of varying the 4-anilino and 7-alkoxy groups of 3-quinolinecarbonitriles on the inhibition of Src kinase activity. Bioorg Med Chem Lett 13: 3797-800 (2003)
- Singh, J; Dobrusin, EM; Fry, DW; Haske, T; Whitty, A; McNamara, DJ Structure-based design of a potent, selective, and irreversible inhibitor of the catalytic domain of the erbB receptor subfamily of protein tyrosine kinases. J Med Chem 40: 1130-5 (1997)
- Sun, S; Zhang, Z; Kodumuru, V; Pokrovskaia, N; Fonarev, J; Jia, Q; Leung, PY; Tran, J; Ratkay, LG; McLaren, DG; Radomski, C; Chowdhury, S; Fu, J; Hubbard, B; Winther, MD; Dales, NA Systematic evaluation of amide bioisosteres leading to the discovery of novel and potent thiazolylimidazolidinone inhibitors of SCD1 for the treatment of metabolic diseases. Bioorg Med Chem Lett 24: 520-5 (2014)
- Ahmed, S; James, K; Owen, CP; Patel, CK; Sampson, L The mechanism of the irreversible inhibition of estrone sulfatase (ES) through the consideration of a range of methane- and amino-sulfonate-based compounds. Bioorg Med Chem Lett 12: 1279-82 (2002)
- Ilyinsky, NS; Shchyolkina, AK; Borisova, OF; Mamaeva, OK; Zvereva, MI; Azhibek, DM; Livshits, MA; Mitkevich, VA; Balzarini, J; Sinkevich, YB; Luzikov, YN; Dezhenkova, LG; Kolotova, ES; Shtil, AA; Shchekotikhin, AE; Kaluzhny, DN Eur J Med Chem 85: 605-14 (2014)
- Funk, OF; Kettmann, V; Drimal, J; Langer, T J Med Chem 47: 2750-60 (2004)
- Phillips, RS; Anderson, AD; Gentry, HG; Güner, OF; Bowen, JP Bioorg Med Chem Lett 27: 1705-1708 (2017)
- Aktaş, DA; Akinalp, G; Sanli, F; Yucel, MA; Gambacorta, N; Nicolotti, O; Karatas, OF; Algul, O; Burmaoglu, S Bioorg Med Chem Lett 30: (2020)
- ChEMBL_2346015 Inhibition of HDAC in human HeLa nuclear extract
- ChEMBL_2346044 Inhibition of HDAC1 in human HeLa nuclear extract
- ChEMBL_2346045 Inhibition of HDAC2 in human HeLa nuclear extract
- ChEMBL_472921 (CHEMBL921164) Inhibition of HDAC1 in rat liver extract
- ChEBML_28421 Inhibition of AICAR formyltransferase from extract of Manca human lymphoma cells
- ChEMBL_1552208 (CHEMBL3761210) Inhibition of HDAC in human HeLa nuclear extract
- ChEMBL_1875110 (CHEMBL4376399) Inhibition of HDAC in human K562 nuclear extract
- ChEMBL_1919932 (CHEMBL4422777) Inhibition of HDAC in human HeLa nuclear extract
- ChEMBL_2439282 Inhibition of HDAC in human HeLa cells nuclear extract
- ChEMBL_69929 (CHEMBL678809) Inhibition of GAR formyltransferase from extract of Manca human lymphoma cells
- ChEMBL_1919890 (CHEMBL4422735) Inhibition of HDAC1/HDAC2 in human HeLa nuclear extract
- ChEMBL_852177 (CHEMBL2157598) Inhibition of aCDase expressed in human HL60 cell extract
- ChEMBL_432005 (CHEMBL918789) Inhibition of telomerase in JR8 cell extract by TRAP assay
- ChEMBL_472923 (CHEMBL921166) Inhibition of HDAC1 in rat liver extract by trypsin assay
- ChEMBL_873193 (CHEMBL2183424) Inhibition of DNA-PK isolated from human HeLa cell extract
- ChEBML_54534 Inhibition of DNA-dependent protein kinase (DNA-PK) of HeLa cell nuclear cell extract
- ChEMBL_209485 (CHEMBL810077) Inhibition of pure human thymidylate synthase from extract of Manca human lymphoma cells
- ChEMBL_87718 (CHEMBL697246) Inhibition of histone deacetylase (HDAC) activity in HeLa cell nuclear extract
- ChEMBL_28279 (CHEMBL645820) Inhibition of AGT activity to 50% of control rate in HT-29 cell extract
- ChEMBL_756042 (CHEMBL1804152) Inhibition of NFkappa p65 isolated from nuclear extract of human HeLa cells by ELISA
- ChEMBL_2105981 (CHEMBL4814656) Inhibition of telomerase in human SGC-7901 cell extract by TRAP assay
- ChEMBL_2201302 (CHEMBL5114010) Inhibition of telomerase derived from human A2780 cell extract by TRAP assay
- ChEMBL_2275541 Inhibition of human HDAC in human HeLa cell nuclear extract by fluorescence assay
- ChEMBL_457624 (CHEMBL923825) Inhibition of HDAC activity in HeLa cell nuclear extract by fluorescent assay
- ChEMBL_583224 (CHEMBL1055023) Inhibition of ALR2 from Sprague-Dawley albino rat lens extract by spectrophotometrically
- ChEMBL_610879 (CHEMBL1065034) Inhibition of HDAC in human HeLa cell nuclear extract by fluorescence assay
- ChEMBL_956022 (CHEMBL2380117) Inhibition of telomerase in human HL60 cell extract by TRAP-LIG assay
- ChEMBL_34783 (CHEMBL646224) In vitro inhibition of Angiotensin I converting enzyme isolated from rabbit lung extract.
- ChEMBL_653705 (CHEMBL1227029) Inhibition of HDAC in human HeLa cell extract by fluorescence plate reader assay
- ChEMBL_1434455 (CHEMBL3388272) Inhibition of HDAC in human HeLa cell extract after 15 mins by fluorescence assay
- ChEMBL_1580211 (CHEMBL3811519) Inhibition of HDAC1 in human Jurkat cells extract after 30 mins by immunoprecipitation assay
- ChEMBL_1580212 (CHEMBL3811520) Inhibition of HDAC3 in human Jurkat cells extract after 30 mins by immunoprecipitation assay
- ChEMBL_1990603 (CHEMBL4624338) Inhibition of NF-kappaB p65 in human HeLa cells nuclear extract by chemiluminescent assay
- ChEMBL_557374 (CHEMBL955704) Inhibition of PSMA in human LNCaP cell extract using [3H]NAAG by radiometric assay
- ChEMBL_2201829 (CHEMBL5114537) Inhibition of recombinant human Top1 derived from human MCF7 cell extract incubated for 30 mins
- ChEMBL_2213599 (CHEMBL5126731) Inhibition of HDAC1 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate
- ChEMBL_2213600 (CHEMBL5126732) Inhibition of HDAC2 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate
- ChEMBL_2213601 (CHEMBL5126733) Inhibition of HDAC8 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate
- ChEMBL_2272806 Inhibition of HDAC1 in human HeLa nuclear extract incubated for 30 mins by fluorescence based analysis
- ChEMBL_2339423 Inhibition of HDAC in human HeLa nuclear extract measured after 30 mins by fluorescence based assay
- ChEMBL_2488043 Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate
- ChEMBL_422105 (CHEMBL907102) In vitro inhibition of histone deacetylase activity using HeLa cell nuclear extract as enzyme source
- ChEMBL_557375 (CHEMBL955705) Inhibition of PSMA in human LNCaP cell extract using [3H]NAAG by fluorescence-based assay
- ChEMBL_776071 (CHEMBL1912767) Inhibition of HDAC in human HeLa cell extract assessed as fluorophore release by fluorescence spectrophotometry
- ChEMBL_1700237 (CHEMBL4051219) Inhibition of HDAC 10 in human HeLa nuclear extract measured after 60 mins by fluorometric analysis
- ChEMBL_2201312 (CHEMBL5114020) Inhibition of telomerase derived from human K562 cell extract incubated for 30 mins by TRAP assay
- ChEMBL_223549 (CHEMBL845855) concentration required to reduce AGT activity to 50% of control rate in HT-29 cell extract.
- ChEMBL_2236190 (CHEMBL5150086) Inhibition of HDAC in human HeLa nuclear extract measured after 30 mins by fluorescence based assay
- ChEMBL_2239302 (CHEMBL5153198) Inhibition of HDAC in human NALM-6 nuclear extract incubated for 48 hrs by fluorometric analysis
- ChEMBL_2274123 Inhibition of human HDAC using human HeLa cell nuclear extract measured after 60 mins by fluorescence assay
- ChEMBL_2373527 Inhibition of HDAC in human HeLa cells nuclear extract incubated for 30 mins by multiplate reader analysis
- ChEMBL_2373528 Inhibition of HDAC1 in human HeLa cells nuclear extract incubated for 30 mins by multiplate reader analysis
- ChEMBL_2460780 Inhibition of HDAC in human HeLa cells nuclear extract incubated for 30 mins by multiplate reader analysis
- ChEMBL_2525403 Inhibition of human HeLa cell nuclear extract purified DNA-PK using p53 peptide as substrate by ELISA
- ChEMBL_28280 (CHEMBL645821) concentration required to reduce AGT activity to 50% of control rate in HT-29 cell extract.
- ChEMBL_614728 (CHEMBL1114231) Inhibition of human HDAC in human HeLa cell nuclear extract after 15 mins by colorimetric assay
- ChEMBL_753553 (CHEMBL1799171) Inhibition of HDAC6 in human HeLa cell nuclear extract after 30 mins by fluorescence microplate reader
- ChEMBL_832314 (CHEMBL2066852) Inhibition of DNMT1 in human HeLa cell nuclear extract assessed as methylated substrate level by ELISA
- ChEMBL_966564 (CHEMBL2399492) Inhibition of HDAC isolated from human HeLa cell nuclear extract after 30 mins by fluorescence assay
- ChEMBL_977181 (CHEMBL2416774) Inhibition of HDAC in human HeLa cell extract using Fluor deLys as substrate by fluorimetric assay
- ChEMBL_1527400 (CHEMBL3636775) Inhibition of human HDAC in HeLa cell nuclear extract by fluorometric assay using Fluor de Lys substrate
- ChEMBL_1728624 (CHEMBL4143902) Inhibition of HDAC in human HeLa nuclear extract using Fluor de Lys as substrate by fluorimetric method
- ChEMBL_1839042 (CHEMBL4339257) Inhibition of HDAC (unknown origin) in human HeLa cell nuclear extract using Color de Lys as substrate
- ChEMBL_2150392 (CHEMBL5034854) Inhibition of human HDAC using human HeLa cell nuclear extract measured after 60 mins by fluorescence assay
- ChEMBL_2201002 (CHEMBL5113710) Inhibition of HDAC1 derived from human HeLa nuclear extract using COLOR DE LYS substrate by colorimetric assay
- ChEMBL_2488159 Inhibition of human HDAC extracted from human HeLa cell nuclear extract incubated for 30 mins by fluorometric analysis
- ChEMBL_1772528 (CHEMBL4224640) Inhibition of chymotrypsin-like activity of 20S proteasome in human PC3 cell extract using Suc-LLVYaminoluciferin as substrate after 2 hrs
- ChEMBL_1772529 (CHEMBL4224641) Inhibition of chymotrypsin-like activity of 20S proteasome in human LNCAP cell extract using Suc-LLVYaminoluciferin as substrate after 2 hrs
- ChEMBL_873187 (CHEMBL2183418) Inhibition of DNA-PK isolated from human HeLa cell extract assessed as inhibition of p53 peptide fragment phosphorylation after 10 mins
- ChEMBL_629937 (CHEMBL1109181) Inhibition of NFkappa p50 isolated from nuclear extract of human HeLa cells assessed as blockade of binding to biotinylated consesus sequence by chemiluminescence assay
- ChEMBL_629938 (CHEMBL1109182) Inhibition of NFkappa p65 isolated from nuclear extract of human HeLa cells assessed as blockade of binding to biotinylated consesus sequence by chemiluminescence assay
- ChEMBL_749381 (CHEMBL1785171) Inhibition of NFkappa p65 in nuclear extract of human HeLa cells assessed as blockade of NFkappa p65 binding to biotinylated-consesus sequence by ELISA
- ChEMBL_1825529 (CHEMBL4325293) Inhibition of PI3Kdelta in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
- ChEMBL_1825530 (CHEMBL4325294) Inhibition of VPS34 in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
- ChEMBL_1986966 (CHEMBL4620513) Inhibition of HDAC in human HeLa cell nuclear extract using fluor-de-lys as substrate by spectrofluorometric analysis
- ChEMBL_2047319 (CHEMBL4702018) Inhibition of HDAC in human HeLa nuclear extract using fluoroscence-labeled acetylated peptide as substrate by fluorometric assay
- ChEMBL_2206578 (CHEMBL5119286) Inhibition of HDAC in human HeLa nuclear extract incubated for 30 mins by fluorescence-based Glo-luminescence assay
- ChEMBL_2488178 Inhibition of HDAC3 in human HeLa cell nuclear extract incubated for 30 mins by fluorescence based microplate reader analysis
- ChEMBL_873195 (CHEMBL2183783) Inhibition of ATM isolated from human HeLa cell extract using glutathione S-transferase-p53N66 as substrate by ELISA
- ChEMBL_714888 (CHEMBL1663834) Inhibition of NF-kappaB p65 isolated from nuclear extract of human HeLa cells assessed as blockade of binding to biotinylated consesus sequence by chemiluminescence assay
- ChEMBL_2355383 Inhibition of HDAC in human HeLa cell nuclear extract using Kac fluorogenic peptide as substrate containing residues 379-382 of p53 by fluorescence assay
- ChEMBL_306888 (CHEMBL828694) In vitro inhibitory concentration against histone deacetylase of DU-145 prostate cell nuclear extract as deacetylation of biotinylated [3H]-acetyl histone H4 peptide
- ChEBML_1684531 Inhibition of AChE1 in Anopheles gambiae body extract using acetylthiocholine iodide as substrate measured over 60 secs by Ellman's method
- ChEMBL_143356 (CHEMBL751280) Inhibitory activity evaluated from soluble cell extract of Neuronal nitric oxide synthase and partially purified by DEAE-sepharose chromatography
- ChEMBL_2157455 (CHEMBL5042115) Inhibition of HDAC in human HeLa nuclear extract using fluorogenic substrate incubated for 30 mins by fluorescence based assay
- ChEMBL_2274135 Inhibition of human HDAC1 using human HeLa cell nuclear extract at 1 uM measured after 60 mins by fluorescence assay
- ChEMBL_2274136 Inhibition of human HDAC2 using human HeLa cell nuclear extract at 1 uM measured after 60 mins by fluorescence assay
- ChEMBL_2274137 Inhibition of human HDAC3 using human HeLa cell nuclear extract at 1 uM measured after 60 mins by fluorescence assay
- ChEMBL_87390 (CHEMBL691505) Tested for Histone deacetylase enzyme inhibition assay using Eimeria tenella extract
- ChEMBL_2310516 Inhibition of recombinant Top1 in Leishmania donovani Ag83 whole cell extract assessed as relaxation of supercoiled pBluescript SK(+) DNA measured by agarose gel electrophoresis analysis
- ChEMBL_1351241 (CHEMBL3271696) Inhibition of HDAC in human HeLa cell nuclear extract using acetylated lysine as substrate after 30 mins by spectrophotometric analysis
- ChEMBL_143357 (CHEMBL751281) Inhibitory activity evaluated from soluble cell extract of human Neuronal nitric oxide synthase and partially purified by DEAE-sepharose chromatography
- ChEMBL_143358 (CHEMBL751652) Inhibitory activity evaluated from soluble cell extract of human nNeuronal nitric oxide synthase and partially purified by DEAE-sepharose chromatography
- ChEMBL_1589349 (CHEMBL3830593) Inhibition of full length BRPF1 in human HUT78 cell nuclear/chromatin extract after 45 mins by chemoproteomic competition binding assay
- ChEMBL_164142 (CHEMBL771466) Compound concentration which displaces 50% of [125I]-labeled 2-5A probe bound to RNase L from mouse L cell extract
- ChEMBL_1684530 (CHEMBL4035009) Inhibition of AChE1 in Anopheles gambiae head extract using acetylthiocholine iodide as substrate measured over 60 secs by Ellman's method
- ChEMBL_1684531 (CHEMBL4035010) Inhibition of AChE1 in Anopheles gambiae body extract using acetylthiocholine iodide as substrate measured over 60 secs by Ellman's method
- ChEMBL_1700230 (CHEMBL4051212) Inhibition of HDAC 1 in human HeLa nuclear extract using HDAC substrate-3 measured after 60 mins by fluorometric analysis
- ChEMBL_1700231 (CHEMBL4051213) Inhibition of HDAC 2 in human HeLa nuclear extract using HDAC substrate-3 measured after 60 mins by fluorometric analysis
- ChEMBL_1700232 (CHEMBL4051214) Inhibition of HDAC 3 in human HeLa nuclear extract using HDAC substrate-3 measured after 60 mins by fluorometric analysis
- ChEMBL_2030958 (CHEMBL4685116) Inhibition of HDAC in human HeLa cell nuclear extract using fluorescence substrate incubated for 30 mins by fluorescence based assay
- ChEMBL_2032352 (CHEMBL4686510) Inhibition of tissue extract derived mEH (unknown origin) using [3H]trans-stilbene oxide as substrate by liquid scintillation counting method
- ChEMBL_2119132 (CHEMBL4828198) Inhibition of PI3Kdelta in human HL-60 cell extract measured after 2 hrs by kinobeads based chemoproteomic competition binding assay
- ChEMBL_2119133 (CHEMBL4828199) Inhibition of VPS34 in human HL-60 cell extract measured after 2 hrs by kinobeads based chemoproteomic competition binding assay
- ChEMBL_809835 (CHEMBL2014772) Inhibition of HDAC6 in human HeLa cells nuclear extract using Fluor-de-Lys as substrate after 30 mins by spectrophotometry
- ChEMBL_812542 (CHEMBL2014417) Inhibition of HDAC1 in human HeLa cells nuclear extract using Fluor-de-Lys as substrate after 30 mins by spectrophotometry
- ChEMBL_89193 (CHEMBL701145) Inhibitory activity evaluated for soluble cell extract of human Inducible nitric oxide synthase and partially purified by DEAE-sepharose chromatography
- ChEMBL_974420 (CHEMBL2412317) Inhibition of HDAC in human HeLa cell extract using fluor de Lys as substrate after 15 mins by fluorometric analysis
- ChEMBL_54532 (CHEMBL664849) Affinity for DNA-dependent protein kinase(DNA-PK) from HeLa cell extract
- ChEMBL_769098 (CHEMBL1832655) Inhibition of STAT3 in mouse NIH3T3/vSrc nuclear extract assessed as disruption of the Stat3-DNA complex pre-incubated for 30 mins by EMSA analysis
- ChEBML_1572320 Inhibition of HDAC in human HeLa nuclear extract using BOC-Ac-Lys-AMC as substrate incubated for 90 mins by fluorescence assay
- ChEMBL_1282340 (CHEMBL3100391) Inhibition of HDAC in human HeLa cell nuclear extract using fluor de Lys as substrate after 15 mins by fluorimetric analysis
- ChEMBL_1551034 (CHEMBL3761048) Inhibition of HDAC in human HeLa cell nuclear extract using BML-KI104 Fluor de Lys as substrate by fluorescence-based assay
- ChEMBL_1551259 (CHEMBL3761968) Inhibition of HDAC in human HeLa cells nuclear extract using Fluor de lys as substrate after 15 mins by fluorometric analysis
- ChEMBL_1570662 (CHEMBL3795030) Inhibition of HDAC in human HeLa nuclear extract using fluor de lys as substrate after 10 to 15 mins by spectrofluorometry
- ChEMBL_1919885 (CHEMBL4422730) Inhibition of HDAC in human HeLa nuclear extract using Fluor-de-lys as substrate measured after 60 mins by fluorescence assay
- ChEMBL_1919886 (CHEMBL4422731) Inhibition of HDAC in human HeLa cytosolic extract using Fluor-de-lys as substrate measured after 60 mins by fluorescence assay
- ChEMBL_2131671 (CHEMBL4841186) Inhibition of HDAC in human HeLa nuclear extract using Fluor de Lys as substrate incubated for 20 mins by fluorometric assay
- ChEMBL_2224455 (CHEMBL5137968) Inhibition of HDAC6 derived from human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate by fluorescence based assay
- ChEMBL_2224456 (CHEMBL5137969) Inhibition of HDAC1 derived from human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate by fluorescence based assay
- ChEMBL_2337887 Inhibition of HDAC in human nuclear extract using Ac-Arg-Gly-Lys(Ac)-AMC as substrate incubated overnight by fluorescence based assay
- ChEMBL_2492889 Inhibition of HDAC1 derived from human HeLa cell extract using Ac-Leu-Gly-Lys (Ac)-AMC as substrate by fluorescence based assay
- ChEMBL_2492890 Inhibition of HDAC2 derived from human HeLa cell extract using Ac-Leu-Gly-Lys (Ac)-AMC as substrate by fluorescence based assay
- ChEMBL_2492891 Inhibition of HDAC3 derived from human HeLa cell extract using Ac-Leu-Gly-Lys (Ac)-AMC as substrate by fluorescence based assay
- ChEMBL_2492892 Inhibition of HDAC6 derived from human HeLa cell extract using Ac-Leu-Gly-Lys (Ac)-AMC as substrate by fluorescence based assay
- ChEMBL_2492893 Inhibition of HDAC7 derived from human HeLa cell extract using Ac-Leu-Gly-Lys (Ac)-AMC as substrate by fluorescence based assay
- ChEMBL_809834 (CHEMBL2014771) Inhibition of HDAC3-NCoR2 in human HeLa cells nuclear extract using Fluor-de-Lys as substrate after 30 mins by spectrophotometry
- ChEMBL_816565 (CHEMBL2025279) Inhibition of HDAC1 in human HeLa cell nuclear extract using Fluor de Lys as substrate after 15 mins by fluorometric analysis
- ChEMBL_816566 (CHEMBL2025280) Inhibition of HDAC6 in human HeLa cell nuclear extract using Fluor de Lys as substrate after 15 mins by fluorometric analysis
- ChEMBL_816567 (CHEMBL2025281) Inhibition of HDAC8 in human HeLa cell nuclear extract using Fluor de Lys as substrate after 15 mins by fluorometric analysis
- ChEMBL_2310567 Inhibition of recombinant Top1 in Antimony resistant Leishmania donovani BHU575 whole cell extract assessed as relaxation of supercoiled pBluescript SK(+) DNA measured by agarose gel electrophoresis analysis
- ChEMBL_87532 (CHEMBL694903) In vitro inhibitory activity against histone deacetylase (HDAC) isolated from HeLa nuclear extract
- ChEMBL_87542 (CHEMBL695140) In vitro inhibitory activity against human histone deacetylase (HDAC) using HeLa nuclear extract
- ChEMBL_1524328 (CHEMBL3632020) Inhibition of Stat3 dimer DNA binding activity in human U251MG cells nuclear extract after 1.5 hrs by EMSA using radiolabeled probe hSIE
- ChEMBL_1524329 (CHEMBL3632021) Inhibition of Stat3 dimer DNA binding activity in human U373MG cells nuclear extract after 1.5 hrs by EMSA using radiolabeled probe hSIE
- ChEMBL_1545338 (CHEMBL3751357) Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (Ac)-AMC as substrate after 60 mins by fluorometric analysis
- ChEMBL_1545348 (CHEMBL3751367) Inhibition of HDAC1 in human HeLa cell nuclear extract using Boc-Lys (Ac)-AMC as substrate after 60 mins by fluorometric analysis
- ChEMBL_1545349 (CHEMBL3751368) Inhibition of HDAC6 in human HeLa cell nuclear extract using Boc-Lys (Ac)-AMC as substrate after 60 mins by fluorometric analysis
- ChEMBL_1545404 (CHEMBL3751629) Inhibition of HDAC8 in human HeLa cell nuclear extract using Boc-Lys (Ac)-AMC as substrate after 60 mins by fluorometric analysis
- ChEMBL_1572320 (CHEMBL3795851) Inhibition of HDAC in human HeLa nuclear extract using BOC-Ac-Lys-AMC as substrate incubated for 90 mins by fluorescence assay
- ChEMBL_1700233 (CHEMBL4051215) Inhibition of HDAC 8 in human HeLa nuclear extract using fluorogenic HDAC class 2A substrate measured after 60 mins by fluorometric analysis
- ChEMBL_1700234 (CHEMBL4051216) Inhibition of HDAC 4 in human HeLa nuclear extract using fluorogenic HDAC class 2A substrate measured after 60 mins by fluorometric analysis
- ChEMBL_1700235 (CHEMBL4051217) Inhibition of HDAC 5 in human HeLa nuclear extract using fluorogenic HDAC class 2A substrate measured after 60 mins by fluorometric analysis
- ChEMBL_1700236 (CHEMBL4051218) Inhibition of HDAC 9 in human HeLa nuclear extract using fluorogenic HDAC class 2A substrate measured after 60 mins by fluorometric analysis
- ChEMBL_1700238 (CHEMBL4051220) Inhibition of HDAC 11 in human HeLa nuclear extract using fluorogenic HDAC class 2A substrate measured after 60 mins by fluorometric analysis
- ChEMBL_1774366 (CHEMBL4231358) Inhibition of HDAC in human HeLa nuclear extract using Ac-Lys(Ac)-pNA as substrate measured after 30 mins by fluorometric analysis
- ChEMBL_1875119 (CHEMBL4376408) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate measured after 30 mins by fluorescence assay
- ChEMBL_1919962 (CHEMBL4422807) Inhibition of HDAC2 in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate measured after 30 mins by fluorescence assay
- ChEMBL_1919963 (CHEMBL4422808) Inhibition of HDAC6 in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate measured after 30 mins by fluorescence assay
- ChEMBL_1919964 (CHEMBL4422809) Inhibition of HDAC8 in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate measured after 30 mins by fluorescence assay
- ChEMBL_2197604 (CHEMBL5110120) Inhibition of HDAC1/HDAC2 in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate and measured by fluorometric method
- ChEMBL_2224821 (CHEMBL5138334) Displacement of [3H]-acetylated histones HDAC6 derived from human K562 cell nuclear extract incubated for 10 mins by liquid scintillation counting method
- ChEMBL_2273494 Inhibition of human recombinant STAT3 assessed as reduction in DNA binding activity with HepG2 nuclear extract incubated for 1 hr by ELISA assay
- ChEMBL_881914 (CHEMBL2212517) Inhibition of topoisomerase-1 in human U251 cells assessed as inhibition of hypoxia-induced HIF-1alpha accumulation in nuclear extract after 6 to 24 hrs by immunoblot analysis
- ChEMBL_1769411 (CHEMBL4221523) Inhibition of HDAC1/CoREST3 in HEK293 whole cell extract using fluorescent acetylated histone peptide as substrate after 60 mins by fluorescence based assay
- ChEMBL_2052178 (CHEMBL4707179) Inhibition of HDAC1 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate measured after 2 hrs by fluorescence based assay
- ChEMBL_2224822 (CHEMBL5138335) Displacement of [3H]-acetylated histones from HDAC1 derived from human K562 cell nuclear extract incubated for 10 mins by liquid scintillation counting method
- ChEMBL_2224823 (CHEMBL5138336) Displacement of [3H]-acetylated histones from HDAC3 derived from human K562 cell nuclear extract incubated for 10 mins by liquid scintillation counting method
- ChEMBL_2452840 Inhibition of HDAC2 in human HeLa cells nuclear extract using BocLys(acetyl)-AMC as substrate incubated for 1 hr by fluorescence plate reader analysis
- ChEMBL_2452841 Inhibition of HDAC4 in human HeLa cells nuclear extract using BocLys(acetyl)-AMC as substrate incubated for 1 hr by fluorescence plate reader analysis
- ChEMBL_2452842 Inhibition of HDAC7 in human HeLa cells nuclear extract using BocLys(acetyl)-AMC as substrate incubated for 1 hr by fluorescence plate reader analysis
- ChEMBL_2452843 Inhibition of HDAC9 in human HeLa cells nuclear extract using BocLys(acetyl)-AMC as substrate incubated for 1 hr by fluorescence plate reader analysis
- ChEMBL_2452845 Inhibition of HDAC11 in human HeLa cells nuclear extract using BocLys(acetyl)-AMC as substrate incubated for 1 hr by fluorescence plate reader analysis
- ChEMBL_65296 (CHEMBL676785) Inhibitory activity evaluated from soluble cell extract of human endothelia constitutive enzyme (Endothelial nitric oxide synthase) and partially purified by DEAE-sepharose chromatography
- ChEMBL_1618726 (CHEMBL3860895) Inhibition of HDAC1/HDAC2 in human HeLa cell nuclear extract preincubated for 20 mins followed by addition of HDAC green as substrate measured after 60 mins by fluorescence analysis
- ChEMBL_2114766 (CHEMBL4823707) Inhibition of DNA-PK isolated from human HeLa nuclear extract using full length His-tagged p53 as substrate measured after 75 mins in presence of ATP by HTRF assay
- ChEMBL_1590578 (CHEMBL3829047) Inhibition of HDAC in human HeLa cell nuclear extract using Ac-Leu-Gly-Lys (Ac)-AMC as substrate after 30 mins by fluorescence assay
- ChEMBL_809836 (CHEMBL2014773) Inhibition of HDAC8 in human HeLa cells nuclear extract using Arg-His-Lys(Ac)-Lys(Ac)-AMC as substrate after 30 mins by spectrophotometry
- ChEMBL_1663210 (CHEMBL4012891) Binding affinity to TNKS1 in human HeLa cell extract after 2 hrs by HTS assay
- ChEMBL_2067854 (CHEMBL4723107) Inhibition of tyrosinase in human HBL cell extract using L-DOPA as substrate measured every 10 mins for 1 hr by MBTH based spectrophotometric method
- ChEMBL_2171587 (CHEMBL5056721) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as fluorogenic substrate measured after 1 hr by flourescence plate reader method
- ChEMBL_653215 (CHEMBL1226418) Inhibition of eIF4A-mediated cap-dependent protein synthesis in FF-HCV-Ren mRNA transfected Swiss mouse Krebs2 cell extract by [35S]methionine metabolic labeling study
- ChEMBL_1663203 (CHEMBL4012884) Binding affinity to PARP1 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
- ChEMBL_1663204 (CHEMBL4012885) Binding affinity to PARP2 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
- ChEMBL_1663205 (CHEMBL4012886) Binding affinity to PARP4 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
- ChEMBL_1663206 (CHEMBL4012887) Binding affinity to PARP11 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
- ChEMBL_1663208 (CHEMBL4012889) Binding affinity to PARP14 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
- ChEMBL_1663209 (CHEMBL4012890) Binding affinity to PARP16 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
- ChEMBL_1663213 (CHEMBL4012894) Binding affinity to PARP10 in human Jurkat cell extract after 45 mins by mass spectrometric analysis
- ChEMBL_2232525 (CHEMBL5146297) Inhibition of CDK2 (unknown origin) in baculovirus infected Sf9 insect cell extract using histone H1 as substrate incubated for 10 mins in presence of [gamma-32P]ATP by radiometric scintillation assay
- ChEMBL_1437098 (CHEMBL3381112) Inhibition of HDAC1/HDAC2 in human HeLa cell extract incubated for 5 mins prior to substrate addition measured after 30 mins by microtitre plate reader analysis
- ChEMBL_1634410 (CHEMBL3877202) Inhibition of immobilized N-LY294002 bead binding to BRD2 (unknown origin) expressed in HEK293T cell nuclear extract incubated for 1 hr by LC-MS/MS analysis
- ChEMBL_1634411 (CHEMBL3877203) Inhibition of immobilized N-LY294002 bead binding to BRD3 (unknown origin) expressed in HEK293T cell nuclear extract incubated for 1 hr by LC-MS/MS analysis
- ChEMBL_1763006 (CHEMBL4198253) Inhibition of HDAC1/2 in human K562 nuclear extract using (QSY-7)-RGGRGLGK(Ac)-GGARRHRK(TAMRA)NH2 as substrate incubated for 30 mins by fluorescence assay
- ChEMBL_984068 (CHEMBL2434426) Inhibition of GST-tagged full length XIAP (unknown origin) assessed as caspase 3/7 reactivation in S-100 cell extract after 4 hrs by fluorescence assay
- ChEMBL_1477045 (CHEMBL3428001) Inhibition of HDAC in human HeLa cell nuclear extract using Fluor de Lys as substrate incubated with compound for 30 mins by microtiter-plate reading flourimeter analysis
- ChEMBL_1763011 (CHEMBL4198258) Inhibition of HDAC in human HeLa nuclear extract preincubated for 10 mins followed by Boc-Lys(acetyl)-AMC substrate addition measured after 30 mins by fluorescence assay
- Enzyme Activity Assay α-Amylase activity was assayed with the chromogenic substrate RBB-starch. An enzyme aliquot was incubated (20 min, 26°C) with 0.3% RBB-starch in 0.1 M Britton-Robinson buffer at the pH optimum of the enzyme (6.5 for Aca s 4 and A. siro extract, 7.0 for D. farinae extract, 6.9 for PPA) or at pH 4.5-9.0 (pH profiling). The reaction was stopped with 0.2 M NaOH, the mixture was centrifuged (10000 g, 10 min), and the absorbance at 620 nm of the supernatant was measured against a control sample (incubated in the absence of enzyme/extract).
- ChEMBL_1555945 (CHEMBL3767300) Inhibition of HDAC1/HDAC2 in human HeLa cells nuclear extract preincubated for 5 mins before Boc-Lys (acetyl)-AMC substrate addition for 30 mins by microplate reader analysis
- ChEMBL_1835547 (CHEMBL4335680) Inhibition of TNF alpha stimulated NF-KappaB p65 in human HeLa nuclear extract assessed as decrease in NF-KappaB translocation to nucleus measured after 5 hrs by ELISA
- ChEMBL_1913618 (CHEMBL4416201) Binding affinity to CDPK4 in Plasmodium falciparum 3D7 blood stage extract incubated for 1 hr in presence of ATP-competitive kinase inhibitor by kinobeads based pull down assay
- ChEMBL_1913620 (CHEMBL4416203) Binding affinity to CDPK1 in Plasmodium falciparum 3D7 blood stage extract incubated for 1 hr in presence of ATP-competitive kinase inhibitor by kinobeads based pull down assay
- ChEMBL_2260085 (CHEMBL5215096) Inhibition of HDAC1 in human HeLa cell nuclear extract using Bos-Lys(acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition incubated for 30 mins
- ChEBML_1769460 Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys-(Ac)-AMC as substrate preincubated for 15 mins followed by substrate addition measured after 60 mins by fluorescence assay
- ChEMBL_1432943 (CHEMBL3383918) Inhibition of 5-LO in human PMNL S100 extract using arachidonic acid as substrate incubated for 15 mins prior to substrate addition measured after 10 mins by HPLC analysis
- ChEMBL_2057508 (CHEMBL4712509) Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubated for 30 mins followed by hSIE probe addition by EMSA analysis
- ChEMBL_2093845 (CHEMBL4775108) Inhibition of human HeLa nuclear extract derived ATM using glutathioneS-transferase-p53N66 as substrate preincubated for 10 mins followed by ATP addition and measured after 1 hr by ELISA
- ChEMBL_2277623 Inhibition of human HDAC4 in HeLa cells extract incubated for 5 mins followed by substrate addition and measured after 15 mins using Fluor-de-Lys as substrate by spectrofluorometric analysis
- ChEMBL_2277624 Inhibition of human HDAC2 in HeLa cells extract incubated for 5 mins followed by substrate addition and measured after 15 mins using Fluor-de-Lys as substrate by spectrofluorometric analysis
- ChEMBL_2277625 Inhibition of human HDAC7 in HeLa cells extract incubated for 5 mins followed by substrate addition and measured after 15 mins using Fluor-de-Lys as substrate by spectrofluorometric analysis
- ChEMBL_2277626 Inhibition of human HDAC8 in HeLa cells extract incubated for 5 mins followed by substrate addition and measured after 15 mins using Fluor-de-Lys as substrate by spectrofluorometric analysis
- ChEMBL_1825526 (CHEMBL4325290) Binding affinity to PI3Kdelta in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
- ChEMBL_1825527 (CHEMBL4325291) Binding affinity to VPS34 in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
- ChEMBL_1825557 (CHEMBL4325321) Binding affinity to PI3Kalpha in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
- ChEMBL_1825558 (CHEMBL4325322) Binding affinity to PI3Kbeta in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
- ChEMBL_1825559 (CHEMBL4325323) Binding affinity to PI3Kgamma in human HL60 cell extract measured after 2 hrs by kinobeads based pull down assay
- ChEMBL_1444367 (CHEMBL3372358) Inhibition of HDAC in human HeLa cell extract using Boc-Lys (acetyl)-AMC as substrate incubated for 10 mins prior to substrate addition measured after 30 mins by fluorescence assay
- ChEMBL_1634379 (CHEMBL3877171) Inhibition of immobilized N-LY294002 bead binding to C-terminal Flag-tagged BRD4 (unknown origin) expressed in HEK293T cell nuclear extract incubated for 1 hr by LC-MS/MS analysis
- ChEMBL_1769460 (CHEMBL4221572) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys-(Ac)-AMC as substrate preincubated for 15 mins followed by substrate addition measured after 60 mins by fluorescence assay
- ChEMBL_1784393 (CHEMBL4255910) Inhibition of STAT3 DNA binding activity in mouse NIH/3T3 nuclear extract preincubated for 30 mins followed by [32P]hSIE addition measured after 30 mins by electrophoretic mobility shift assay
- ChEMBL_1797560 (CHEMBL4269677) Inhibition of ATR in human HeLa cell nuclear extract using GST-fused p53N66 as substrate preincubated for 10 mins followed by ATP addition and measured after 1 hr by ELISA
- ChEMBL_1867771 (CHEMBL4368746) Inhibition of HDAC4 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorometric assay
- ChEMBL_1867772 (CHEMBL4368747) Inhibition of HDAC5 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorometric assay
- ChEMBL_1867773 (CHEMBL4368748) Inhibition of HDAC7 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorometric assay
- ChEMBL_1867774 (CHEMBL4368749) Inhibition of HDAC9 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorometric assay
- ChEMBL_1867775 (CHEMBL4368750) Inhibition of HDAC6 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorometric assay
- ChEMBL_2057507 (CHEMBL4712508) Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract preincubated for 30 mins followed by hSIE probe addition by EMSA analysis
- ChEMBL_2197605 (CHEMBL5110121) Inhibition of HDAC1 in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(triflouroacetyl)-AMC as substrate incubated for 30 mins and measured by fluorescence assay
- ChEMBL_2197606 (CHEMBL5110122) Inhibition of HDAC6 in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(triflouroacetyl)-AMC as substrate incubated for 30 mins and measured by fluorescence assay
- ChEMBL_2197607 (CHEMBL5110123) Inhibition of HDAC8 in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(triflouroacetyl)-AMC as substrate incubated for 30 mins and measured by fluorescence assay
- ChEMBL_1895949 (CHEMBL4397984) Inhibition of HDAC in human HeLa cell nuclear extract assessed as decrease in deacetylation of FLUOR DE LYS Green substrate preincubated for 10 mins followed by substrate addition and measured after 30 mins by fluorescence based assay
- ChEMBL_1763428 (CHEMBL4198675) Inhibition of HDAC1/2 in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorescence assay
- ChEMBL_1769470 (CHEMBL4221582) Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (acetyl)-AMC as substrate preincubated for 10 mins followed by substrate addition measured after 30 mins by fluorescence assay
- ChEMBL_1769471 (CHEMBL4221583) Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorescence assay
- ChEMBL_1781393 (CHEMBL4252910) Inhibition of HDAC in human HeLa cell extract using Fluor de Lys-Green as substrate preincubated for 5 mins followed by substrate addition and measured after 1 hr by fluorescence assay
- ChEMBL_1847057 (CHEMBL4347598) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
- ChEMBL_1936352 (CHEMBL4482111) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate preincubated for 10 mins followed by substrate addition and measured after 30 mins by fluorescence assay
- ChEMBL_1936353 (CHEMBL4482112) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
- ChEMBL_830578 (CHEMBL2061433) Inhibition of human Tdp1 in Tdp1-deficient chicken DT40 whole cell extract using 5'-[32P]-labeled single-stranded DNA oligonucleotide containing 3'-phosphotyrosine as substrate after 15 mins by PAGE analysis
- ChEMBL_1913617 (CHEMBL4416200) Binding affinity to CDPK4 in Plasmodium falciparum 3D7 blood stage extract incubated for 1 hr by kinobeads based pull down assay
- ChEMBL_1913619 (CHEMBL4416202) Binding affinity to CDPK1 in Plasmodium falciparum 3D7 blood stage extract incubated for 1 hr by kinobeads based pull down assay
- ChEMBL_1913623 (CHEMBL4416206) Binding affinity to CK1 in Plasmodium falciparum 3D7 blood stage extract incubated for 1 hr by kinobeads based pull down assay
- ChEMBL_1551388 (CHEMBL3762509) Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 15 mins followed by substrate addition measured after 60 mins by fluorescence-based assay
- ChEMBL_1683516 (CHEMBL4033995) Inhibition of HDAC1/2 in human HeLa cell nuclear extract using COLOR DE LYS as substrate pretreated for 5 mins followed by substrate addition measured after 30 mins by UV-absorption method
- ChEMBL_1893047 (CHEMBL4394968) Inhibition of HDAC in human HeLa cell nuclear extract using fluor-de-lys-green as substrate preincubated for 10 mins followed by substrate addition and measured after 30 mins by fluorescence assay
- ChEMBL_2057493 (CHEMBL4712494) Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT3 SH2 domain in mouse NIH3T3/v-Src nuclear extract preincubated for 30 mins followed by hSIE probe addition by EMSA analysis
- ChEMBL_2213936 (CHEMBL5127068) Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by microplate reader analysis
- ChEMBL_2268733 Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence based analysis
- ChEMBL_2268738 Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (acetyl)-AMC as substrate preincubated for 15 mins followed by substrate addition and measured after 60 mins by fluorescence based analysis
- ChEMBL_2273479 Inhibition of recombinant STAT3 (unknown origin) expressed in baculovirus in Sf9 insect cells assessed as reduction in DNA binding activity with NIH3T3 nuclear extract incubated for 30 mins by electrophoretic mobility shift assay
- ChEMBL_2488040 Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 15 mins followed by substrate addition and measured after 60 mins by fluorescence based analysis
- ChEMBL_1553268 (CHEMBL3767500) Inhibition of HDAC1/2 in human HeLa cell nuclear extract using color de Lys as substrate preincubated for 5 mins followed by substrate addition measured after 30 min by microtiter plate reader analysis
- ChEMBL_1750439 (CHEMBL4185199) Inhibition of HDAC1 in Plasmodium falciparum 3D7 nuclear extract using Ac-RGK(Ac)-AMC fluorogenic peptide as substrate preincubated for 1 hr followed by substrate addition measured after 10 min by fluorescence assay
- ChEMBL_1760362 (CHEMBL4195370) Inhibition of HDAC in human HeLa cell nuclear extract using fluorogenic Boc-Lys(acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorescence-based assay
- ChEMBL_2050950 (CHEMBL4705649) Inhibition of FAM-Bim peptide binding to human full-length N-terminal His6-tagged Bcl2 (2 to 206 residues) expressed in Escherichia coli S12 extract measured after 30 mins by fluorescence polarization assay
- ChEMBL_2031685 (CHEMBL4685843) Inhibition of class 1 HDAC in human HeLa cell nuclear extract using Boc-Lys(Ac)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
- ChEMBL_2273504 Inhibition of recombinant STAT3 (unknown origin) expressed in Escherichia coli BL21 (DE3) cells assessed as reduction in DNA binding activity with SK-MEL-5 nuclear extract incubated for 30 mins by electrophoretic mobility shift assay
- ChEMBL_2475467 Inhibition of C-terminal 6His-tagged recombinant human STAT3 (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 10 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
- ChEMBL_2475468 Inhibition of C-terminal 6His-tagged recombinant human STAT3 (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
- ChEMBL_2475469 Inhibition of C-terminal 6His-tagged recombinant human STAT3 (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 60 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
- ChEMBL_2298866 Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(Tfa)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
- ChEMBL_2496980 Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(Tfa)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
- ChEMBL_2496998 Inhibition of HDAC1 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(Tfa)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
- ChEMBL_2496999 Inhibition of HDAC2 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(Tfa)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
- ChEMBL_2497000 Inhibition of HDAC3 in human HeLa nuclear extract using Boc-Lys(Ac)-AMC or Boc-Lys(Tfa)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
- ChEMBL_887090 (CHEMBL2214315) Inhibition of Apaf-1-caspase 9-cytochrome c-caspase 3 complex in human HEK293 cytosolic extract using afc-DEVD as substrate preincubated for 30 mins before substrate addition measured after 30 mins by fluorescence assay
- ChEMBL_2018354 (CHEMBL4671932) Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC or Boc-Lys (triflouroacetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay
- ChEMBL_2260034 (CHEMBL5215045) Inhibition of HDAC-1 (unknown origin) expressed in Escherichia coli BL21 (DE3) in HeLa nuclear extract using KI177 as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by Bradford reagent method
- ChEMBL_2050946 (CHEMBL4705645) Binding affinity to human full-length N-terminal His6-tagged Bcl2 (2 to 206 residues) expressed in Escherichia coli S12 extract by isothermal titration calorimetry
- ChEMBL_34793 (CHEMBL643770) In vitro inhibitory activity against Angiotensin I converting enzyme (ACE) isolated from rabbit lung extract using hippuryl-L-histidyl-L-leucine (HHL) as the substrate
- ChEMBL_1738015 (CHEMBL4153765) Inhibition of ATM derived from human HeLa cell nuclear extract using glutathione S-transferase p53N66 as substrate preincubated for 10 mins followed by ATP addition and subsequent incubation for 1 hr measured after 1.5 hrs by ELISA
- ChEMBL_2475470 Inhibition of recombinant wild type tyrosine phosphorylated C-terminal 6His tagged human STAT3 (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
- ChEMBL_2260035 (CHEMBL5215046) Inhibition of HDAC-6 (unknown origin) expressed in Escherichia coli BL21 (DE3) in HeLa nuclear extract using Boc-Lys(TFA)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by Bradford reagent method
- ChEMBL_2050947 (CHEMBL4705646) Binding affinity to human full-length N-terminal His6-tagged prephosphorylated Bcl2 (2 to 206 residues) expressed in Escherichia coli S12 extract by isothermal titration calorimetry
- ChEMBL_2475471 Inhibition of recombinant wild type tyrosine phosphorylated C-terminal 6His tagged human STAT3 C328A mutant (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
- ChEMBL_2475472 Inhibition of recombinant wild type tyrosine phosphorylated C-terminal 6His tagged human STAT3 C426A mutant (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
- ChEMBL_2475473 Inhibition of recombinant wild type tyrosine phosphorylated C-terminal 6His tagged human STAT3 C468A mutant (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
- ChEMBL_2475474 Inhibition of recombinant wild type tyrosine phosphorylated C-terminal 6His tagged human STAT3 C542S mutant (127 to 711 residues) DNA-binding activity transfected in v-Src transformed mouse NIH3T3 cell nuclear extract preincubated for 30 mins followed by addition of radiolabeled hSIE and measured after 30 mins by EMSA analysis
- Enzyme Assay ATR for use in the in vitro enzyme assay was obtained from HeLa nuclear extract (CIL Biotech, Mons, Belgium) by immunoprecipitation with rabbit polycolonal antiserum raised to amino acids 400-480 of ATR (Tibbetts R S et, al, 1999, GenesDev.13:152-157).
- Biological Assay For mTOR enzyme activity assays, mTOR protein was isolated from HeLa cell cytoplasmic extract by immunoprecipitation, and activity determined essentially as described previously using recombinant PHAS-1as a substrate (ref 21).
- ChEMBL_2050942 (CHEMBL4705641) Binding affinity to human full-length N-terminal His6-tagged Bcl2 (2 to 206 residues) expressed in Escherichia coli S12 extract after 30 mins using FAM-labelled compound by fluorescence polarization assay
- Fluor de Lys Assay Fluor de Lys is a fluorescence based HDAC activity assay comprising a combination of fluorogenic Histone deAcetylase Lysyl substrate and a developer. The kit is a highly sensitive and convenient alternative to radiolabeled, acetylated histones or peptide/HPLC methods for the assay of histone deacetylases. This assay is based on the ability of HeLa nuclear extract, which is enriched in HDAC activity, to mediate the deacetylation of the acetylated lysine side chain of the Fluor de Lys substrate. The assay procedure requires two steps. First, incubation of the HeLa nuclear extract with the Fluor de Lys substrate results in substrate deacetylation and thus sensitizes it to the second step. In the second step, treatment of the deacetylated substrate with the Fluor de Lys developer produces a fluorophore. The substrate-developer reaction, under normal circumstances goes to completion in less than 1 min at 25 C.
- HDAC enzyme inhibitionAssay HDAC enzyme inhibition assays were performed using purified HDACs 1-10 essentially as described in Beckers et al., 2007, Int. J. Cancer., 121:1138-48 and Perez-Balado et al., 2007, J. Med. Chem., 50:2497-2505. Inhibition assays using nuclear extract were performed essentially as described in Herman et al., 2006, Nat. Chem. Biol., 2:551-558. Briefly, the purified HDACs or nuclear extract were incubated with an acetylated substrate in the absence of the compound to be assayed and with increasing concentrations of the compound. The rate of substrate deacetylation was measured under each condition, and half-maximal inhibitory concentration with regard to each HDAC was determined by standard means.
- ChEMBL_2050943 (CHEMBL4705642) Binding affinity to human full-length N-terminal His6-tagged prephosphorylated Bcl2 (2 to 206 residues) expressed in Escherichia coli S12 extract after 30 mins using FAM-labelled compound by fluorescence polarization assay
- PDE3A Enzyme Inhibition Assay For the determination of the in vitro effect of example compounds on the PDE3A reactions 2 μl of the respective example compound solution in DMSO (serial dilutions) were placed in wells of microtiter plates (Isoplate-96/200W; Perkin Elmer). 50 μl of a dilution of PDE3A cell extract from Sf9 cells overexpressing human full length PDE3A (SB Drug Discovery, UK) in buffer A (50 mM Tris/HCl pH 7.5, 8.3 mM MgCl2, 1.7 mM EDTA, 0.2% BSA) was added. The dilution of the PDE3A cell extract was chosen such that the reaction kinetics was linear and less than 70% of the substrate was consumed (typical dilution 1:5000). The reaction was started by addition of 50 μl (0.025 μCi) of 1:2000 in buffer A w/o BSA diluted substrate [8-3H]adenosine 3′, 5′-cyclic phosphate (1 μCi/μl; Perkin Elmer). After incubation at room temperature for 60 min, the reaction was stopped by addition of 25 μl of a suspension containing 18 mg/ml yttrium scintillation proximity beads (Perkin Elmer) in water. The microtiter plates were sealed and measured in a Microbeta scintillation counter (PerkinElmer Wallac).
- Enzyme inhibition assay The nucleus extract was extracted from HDAC8 enzyme was expressed in Escherichia coli. Boc-Lys (acetyl)-AMC was used as the substrate of HDAC. SAHA which is the HDAC inhibitor on market was used as a positive control. The compounds were diluted to six concentrations (25, 5, 1, 0.2, 0.04 and 0.008 uM/L) to investigate their ability of inhibiting HDAC activity.
- Electrophoretic Mobility Shift Assay (EMSA) His10-Stat3 was expressed in Sf9 cells from a baculovirus encoding the recombinant protein. A nuclear extract of the Sf9 cells was incubated with 32P-labeled high affinity c-fos sis inducible element (hSIE) either alone or in the presence of inhibitor. After 20 min of incubation, samples were electrophoresed on polyacrylamide gels. The gels were dried, exposed to a phosphorimager screen and scanned. IC50 values were derived from plots of spot intensity versus phosphopeptide concentration. The affinity of peptides to the SH2 domain is measured by the intensity of the radioactivity of the Stat3-DNA complex band in the electrophoresis gel.
- Biological Activity Assay The KDM1A demethylase enzyme activity can obtained from mammalian cells or tissues expressing KDM1A from an endogenous or recombinant gene and purified or assayed from a whole cell extract. These methods can be used to determine the concentration of the disclosed compounds can inhibit fifty percent of the enzyme activity (IC50). In one aspect, the disclosed compounds exhibit inhibition fifty percent of the KDM1A enzyme activity at a concentration of less than 500 nM, less than 100 nM, less than 50 nM or less than 10 nM.
- Electrophoretic Mobility Shift Assay (EMSA) STAT proteins were expressed in Sf9 cells from a baculovirus encoding the recombinant protein. A nuclear extract of the Sf9 cells was incubated with 32P-labeled high affinity c-fos sis inducible element (hSIE) either alone or in the presence of inhibitor. After incubation, samples were electrophoresed on polyacrylamide gels. The gels were dried, exposed to a phosphorimager screen and scanned. IC50 values were derived from plots of spot intensity versus phosphopeptide concentration. The affinity of peptides to the SH2 domain is measured by the intensity of the radioactivity of the Stat-DNA complex band in the electrophoresis gel.
- PDE3B Enzyme Inhibition Assay The commercially available 3H-cAMP Scintillation Proximity Assay (SPA, Perkin Elmer) system was used for enzyme inhibition studies. For the determination of the in vitro effect of example compounds on the PDE3B reactions 2 μl of the respective example compound solution in DMSO (serial dilutions) were placed in wells of microtiter plates (Isoplate-96/200W; Perkin Elmer). 50 μl of a dilution of PDE3B cell extract from Sf9 cells overexpressing human full length PDE3B (SB Drug Discovery, UK) in buffer A (50 mM Tris/HCl pH 7.5, 8.3 mM MgCl2, 1.7 mM EDTA, 0.2% BSA) was added. The dilution of the PDE3B cell extract was chosen such that the reaction kinetics was linear and less than 70% of the substrate was consumed (typical dilution 1:6000). The reaction was started by addition of 50 μl (0.025 μCi) of 1:2000 in buffer A w/o BSA diluted substrate [8-3H]adenosine 3′, 5′-cyclic phosphate (1 μCi/μl; Perkin Elmer). After incubation at room temperature for 60 min, the reaction was stopped by addition of 25 μl of a suspension containing 18 mg/ml yttrium scintillation proximity beads (Perkin Elmer) in water. The microtiter plates were sealed and measured in a Microbeta scintillation counter (PerkinElmer Wallac). IC50 values were determined from sigmoidal curves by plotting percentage PDE3B activity vs log compound concentration.
- In Vitro Inhibition Assay This work was performed at the MDS Pharma Services, Pharmacology Laboratories, Taiwan. The assay was an in vitro evaluation of the ability of an extract or a pure compound to inhibit the steroid 5alpha -reductase enzyme from metabolizing testosterone into dihydrotestosterone. This is an enzyme-immunoassay (EIA) for quantitative determination of testosterone in human serum or plasma. The significance of this type of inhibition is that it can lead to eradication of benign prostatic hyperplasia (BPH). Two distinct isozymes are found in mice, rats, monkeys and humans: type 1 and II. Each of these isozymes is differentially expressed in tissues and developmental stages. In human, type 1 steroid 5alpha -reductase is predominant in the sebaceous glands of most regions of skin, including scalp and liver and is responsible for approximately one third of circulating DHT. Inhibitors of steroid 5alpha -reductase may be of benefit in the treatment of androgenetic alopecia.
- FASN Inhibition FASN activity of the SKBr3 cell extract was determined by measuring either NADPH oxidation or the amount of thiol-containing coenzyme A (CoA) released during the fatty acid synthase reaction. The dye CPM (7-diethylamino-3-(4′-maleimidyl-phenyl)-4-methylcoumarin) contains a thiol reactive group that increases its fluorescence emission on reaction with the sulfhydryl group of CoA. The biochemical activities shown in TABLE 31 were determined using the fluorescence measurement of CoA release via a procedure described in Chung C. C. et al. (Assay and Drug Development Technologies, 2008, 6(3), 361-374).
- PDE3A Enzyme Inhibition The commercially available 3H-cAMP Scintillation Proximity Assay (SPA, Perkin Elmer) system was used for enzyme inhibition studies. For the determination of the in vitro effect of example compounds on the PDE3A reactions 2 μl of the respective example compound solution in DMSO (serial dilutions) were placed in wells of microtiter plates (Isoplate-96/200W; Perkin Elmer). 50 μl of a dilution of PDE3A cell extract from Sf9 cells overexpressing human full length PDE3A (SB Drug Discovery, UK) in buffer A (50 mM Tris/HCl pH 7.5, 8.3 mM MgCl2, 1.7 mM EDTA, 0.2% BSA) was added. The dilution of the PDE3A cell extract was chosen such that the reaction kinetics was linear and less than 70% of the substrate was consumed (typical dilution 1:5000). The reaction was started by addition of 50 μl (0.025 μCi) of 1:2000 in buffer A w/o BSA diluted substrate [8-3H]adenosine 3′, 5′-cyclic phosphate (1 μCi/μl; Perkin Elmer). After incubation at room temperature for 60 min, the reaction was stopped by addition of 25 μl of a suspension containing 18 mg/ml yttrium scintillation proximity beads (Perkin Elmer) in water. The microtiter plates were sealed and measured in a Microbeta scintillation counter (PerkinElmer Wallac). IC50 values were determined from sigmoidal curves by plotting percentage PDE3A activity vs log compound concentration.
- PDE3A Enzyme Inhibition The commercially available 3H-cAMP Scintillation Proximity Assay (SPA, Perkin Elmer) system was used for enzyme inhibition studies. For the determination of the in vitro effect of test substances on the PDE3A reactions 2 μl of the respective test compound solution in DMSO (serial dilutions) were is placed in wells of microtiter plates (Isoplate-96/200W; Perkin Elmer). 50 μl of a dilution of PDE3A cell extract from Sf9 cells overexpressing human full length PDE3A (SB Drug Discovery, UK) in buffer A (50 mM Tris/HCl pH 7.5, 8.3 mM MgCl2, 1.7 mM EDTA, 0.2% BSA) was added. The dilution of the PDE3A cell extract was chosen such that the reaction kinetics was linear and less than 70% of the substrate was consumed (typical dilution 1:5000). The reaction was started by addition of 50 μl (0.025 μCi) of 1:2000 in buffer A w/o BSA diluted substrate [8-3H] adenosine 3′,5′-cyclic phosphate (1 μCi/μl; Perkin Elmer). After incubation at room temperature for 60 min, the reaction was stopped by addition of 25 μl of a suspension containing 18 mg/ml yttrium scintillation proximity beads (Perkin Elmer) in water. The microtiter plates were sealed and measured in a Microbeta scintillation counter (PerkinElmer Wallac). IC50 values were determined from sigmoidal curves by plotting percentage PDE3A activity vs log compound concentration.
- PDE3B Enzyme Inhibition The commercially available 3H-cAMP Scintillation Proximity Assay (SPA, Perkin Elmer) system was used for enzyme inhibition studies. For the determination of the in vitro effect of example compounds on the PDE3B reactions 2 μl of the respective example compound solution in DMSO (serial dilutions) were placed in wells of microtiter plates (Isoplate-96/200W; Perkin Elmer). 50 μl of a dilution of PDE3B cell extract from Sf9 cells overexpressing human full length PDE3B (SB Drug Discovery, UK) in buffer A (50 mM Tris/HCl pH 7.5, 8.3 mM MgCl2, 1.7 mM EDTA, 0.2% BSA) was added. The dilution of the PDE3B cell extract was chosen such that the reaction kinetics was linear and less than 70% of the substrate was consumed (typical dilution 1:6000). The reaction was started by addition of 50 μl (0.025 μCi) of 1:2000 in buffer A w/o BSA diluted substrate [8-3H]adenosine 3′, 5′-cyclic phosphate (1 μCi/μl; Perkin Elmer). After incubation at room temperature for 60 min, the reaction was stopped by addition of 25 μl of a suspension containing 18 mg/ml yttrium scintillation proximity beads (Perkin Elmer) in water. The microtiter plates were sealed and measured in a Microbeta scintillation counter (PerkinElmer Wallac). IC50 values were determined from sigmoidal curves by plotting percentage PDE3B activity vs log compound concentration.
- PDE3B Enzyme Inhibition The commercially available 3H-cAMP Scintillation Proximity Assay (SPA, Perkin Elmer) system was used for enzyme inhibition studies. For the determination of the in vitro effect of test substances on the PDE3B reactions 2 μl of the respective test compound solution in DMSO (serial dilutions) were placed in wells of microtiter plates (Isoplate-96/200W; Perkin Elmer). 50 μl of a dilution of PDE3B cell extract from Sf9 cells overexpressing human full length PDE3B (SB Drug Discovery, UK) in buffer A (50 mM Tris/HCl pH 7.5, 8.3 mM MgCl2, 1.7 mM EDTA, 0.2% BSA) was added. The dilution of the PDE3B cell extract was chosen such that the reaction kinetics was linear and less than 70% of the substrate was consumed (typical dilution 1:6000). The reaction was started by addition of 50 μl (0.025 μCi) of 1:2000 in buffer A w/o BSA diluted substrate [8-3H] adenosine 3′,5′-cyclic phosphate (1 μCi/μl; Perkin Elmer). After incubation at room temperature for 60 min, the reaction was stopped by addition of 25 μl of a suspension containing 18 mg/ml yttrium scintillation proximity beads (Perkin Elmer) in water. The microtiter plates were sealed and measured in a Microbeta scintillation counter (PerkinElmer Wallac). IC50 values were determined from sigmoidal curves by plotting percentage PDE3B activity vs log compound concentration.
- CB1 and CB2 Binding Inhibition by Compounds Purified from Milicia excelsa (African Teak) The organic extract (8 g) from the stem barks of Milicia excelsa, obtained using the methods described in Example 1, was divided and loaded separately onto two pre-packed flash columns (120 g silica, particle size 32-60 μm, 4 cm×19 cm), then the column was eluted with the gradient as described in Example 5. A Diels-Alder adduct of a chalcone and prenylphenyl moiety was isolated from one of the active fractions and identified as Sanggenon C/D/.
- ChEMBL_440740 (CHEMBL888711) Inhibition of human LBD of of ERalpha
- RORgamma Gal4 Reporter Gene Assay (FF) Cells were incubated for additional 16 h before firefly (FF) luciferase activities were measured sequentially in the same cell extract using a Dual-Light-Luciferase-Assay system (Dyer et al., Anal. Biochem. 2000, 282:158). All experiments were done at least in triplicates.
- RORgamma Gal4 Reporter Gene Assay (REN) Cells were incubated for additional 16 h before renilla (REN) luciferase activities were measured sequentially in the same cell extract using a Dual-Light-Luciferase-Assay system (Dyer et al., Anal. Biochem. 2000, 282:158). All experiments were done at least in triplicates.
- In vitro HDACs Inhibition Fluorescence Assay In brief, 10 μL of HeLa nuclear extract was mixed with various concentrations of target compounds (50 μL), SAHA, using 100% and none HDACs groups as control group, and the mixture. After incubation at 37 °C for 10 min, fluorogenic substrate Boc-Lys (acetyl)-AMC (40 μL) was added and then the mixture was incubated at 37 °C for 30 min. The mixture was stopped by addition of 100 μL of developer containing trypsin and TSA afterward. Over the next incubation at 37 °C for 20 min, fluorescence intensity was measured using a microplate reader at excitation and emission wavelengths of 390 and 460 nm, respectively.
- ChEBML_209063 Inhibition of amidolytic activity of thrombin
- ChEBML_211872 Inhibition of the polymerization of tubulin
- ChEMBL_333145 (CHEMBL865913) Inhibition of reuptake of 5HT
- ChEMBL_333146 (CHEMBL865923) Inhibition of reuptake of Norepinephrine
- ChEMBL_2267427 Inhibition of human cdc7 incubation of 30 mins in presence of ATP
- ChEMBL_2267428 Inhibition of human CDK9 incubation of 30 mins in presence of ATP
- ChEMBL_66597 (CHEMBL680028) Inhibition of autophosphorylation of cytoplasmic domain of epidermal growth factor receptor
- Biological Activity Assay Assaying the inhibition of KDM1A can be determined in vitro, in cultured cells, and in animals. There are a variety of spectrophotometric methods to detect the results of demethylation of methylated lysines, viz., detecting the products of KDM1A demethylase oxidative activity on a peptide fragment of at least 18 amino acid representing the N-terminus of the histone H3 substrate that contains a monomethyl at the fourth lysine residue. Hydrogen peroxide, one product of the KDM1A demethylase reaction, reacts with horseradish peroxidase and dihydroxyphenoxazine (ADHP) to produce the fluorescent compound resorufin (excitation=530-560 nm:emission=590 nm). The KDM1A demethylase enzyme activity can obtained from mammalian cells or tissues expressing KDM1A from an endogenous or recombinant gene and purified or assayed from a whole cell extract. These methods can be used to determine the concentration of the disclosed compounds can inhibit fifty percent of the enzyme activity (IC50). In one aspect, the disclosed compounds exhibit inhibition fifty percent of the KDM1A enzyme activity at a concentration of less than 500 nM, less than 100 nM, less than 50 nM or less than 10 nM.
- ChEMBL_184451 (CHEMBL789405) Inhibition of adenosine stimulated accumulation of cyclic AMP at Adenosine A2 receptor of VA13 fibroblasts of rat
- Inhibition of Histone Deacetylase Enzymatic Assay For deacetylase assays, 20,000 cpm of the [3H]-metabolically labeled acetylated histone substrate (M. Yoshida et al., J. Biol. Chem. 265(28): 17174-17179 (1990)) is incubated with 30 ug of H446 nuclear extract or an equivalent amount of the cloned recombinant hHDAC-1 for 10 minutes at 37 C. The reaction is stopped by adding acetic acid (0.04 M, final concentration) and HCl (250 mM, final concentration). The mixture is extracted with ethyl acetate and the released [3H]-acetic acid was quantified by scintillation counting. For inhibition studies, the enzyme is preincubated with compounds at 4 C. for 30 minutes prior to initiation of the enzymatic assay. IC50 values for HDAC enzyme inhibitors are determined by performing dose response curves with individual compounds and determining the concentration of inhibitor producing fifty percent of the maximal inhibition. Alternatively, the following protocol is used to assay the compounds of the invention.
- ChEBML_155363 Inhibition of phosphodiesterase 5 of rabbit platelets
- ChEBML_208905 Evaluation of inhibition of transition state thrombin
- ChEBML_212014 Tested for inhibition of polymerization of tubulin
- ChEBML_305045 Inhibition of Beta-glucosidase of rat intestine
- ChEBML_305098 Inhibition of Beta-galactosidase of bovine liver
- ChEBML_41589 Inhibition of (BChE) Butyrylcholinesterase of horse serum
- ChEMBL_154561 (CHEMBL757896) Inhibition of PDE5 of human platelets
- ChEMBL_154562 (CHEMBL757897) Inhibition of PDE5 of human platelets
- ChEMBL_2277852 Induction of degradation of FKBP12 (unknown origin)
- ChEMBL_2277853 Induction of degradation of USP7 (unknown origin)
- ChEMBL_429830 (CHEMBL915411) Inhibition of dimerization of HIV1 protease
- ChEMBL_440741 (CHEMBL888712) Inhibition of human LBD of ERbeta
- ChEMBL_529187 (CHEMBL974963) Inhibition of peptidase activity of CPP32
- ChEMBL_760063 (CHEMBL1810386) Inhibition of auto-phosphorylation of IGFR1
- ChEMBL_770210 (CHEMBL1833000) Inhibition of first bromodomain of BRD2
- ChEMBL_770211 (CHEMBL1833001) Inhibition of first bromodomain of BRD4
- ChEMBL_1513226 (CHEMBL3610934) Inhibition of PAK1 (unknown origin) in presence of 1.5 uM of ATP
- ChEMBL_1513227 (CHEMBL3610935) Inhibition of PAK1 (unknown origin) in presence of 15 uM of ATP
- ChEMBL_1513228 (CHEMBL3610936) Inhibition of PAK1 (unknown origin) in presence of 150 uM of ATP
- ChEMBL_88782 (CHEMBL699440) Inhibitory concentration of compound against strand transfer of of HIV-2 integrase
- ChEBML_71792 Inhibition of human GGTase-catalyzed incorporation of [3H]GGPP into biotinylated peptide of C-terminal of human K-Ras
- ChEMBL_2127677 (CHEMBL4837022) Inhibition of eIF4A (unknown origin) assessed as inhibition of translation of RNA featuring short 5'-UTR of tubulin
- Tyrosinase Inhibition Assay Briefly, mushroom tyrosinase (1250 units/mL) and 2 mM L-tyrosine (0.07 mL) were added to a solution of phosphate buffer (0.1 M, pH 6.8, 0.09 mL) containing the test sample. The test mixture (0.2 mL) was incubated for 10 min at 37°C and the absorption due to the formation of dopachrome was monitored at 475 nm. The same mixture except for the plant extract was used as a control. Arbutin (hydroquinone-O-β-glucopyranoside) was used as a positive control. Each treatment was replicated three times.
- ChEMBL_71792 (CHEMBL686003) Inhibition of human GGTase-catalyzed incorporation of [3H]GGPP into biotinylated peptide of C-terminal of human K-Ras
- ChEBML_99764 Kinetic constant for inactivation of MAO B from replot of half-lives of inactivation
- ChEMBL_1478084 (CHEMBL3430146) Inhibition of human FPPS in absence of pre-incubation of compound with enzyme
- ChEMBL_1549975 (CHEMBL3755273) Inhibition of human plasmin assessed as inhibition of fibrinolysis in presence of fibrinogen
- ChEMBL_1549976 (CHEMBL3755274) Inhibition of human plasmin assessed as inhibition of fibrinogenolysis in presence of fibrinogen
- ChEMBL_1549977 (CHEMBL3755275) Inhibition of human plasmin assessed as inhibition of amidolysis in presence of fibrinogen
- ChEMBL_214787 (CHEMBL815524) Inhibition of [3H]nitrendipine binding to membrane homogenates of of rat cardiac muscle.
- ChEMBL_2317870 Inhibition of JAK1 JH1 domain (unknown origin) in presence of 1 mM of ATP
- ChEMBL_2317871 Inhibition of JAK2 JH1 domain (unknown origin) in presence of 1 mM of ATP
- ChEMBL_2317872 Inhibition of JAK3 JH1 domain (unknown origin) in presence of 1 mM of ATP
- ChEMBL_2317873 Inhibition of TYK2 JH1 domain (unknown origin) in presence of 1 mM of ATP
- ChEMBL_2317874 Inhibition of JAK1 JH1 domain (unknown origin) in presence of 10 uM of ATP
- ChEMBL_2317875 Inhibition of JAK2 JH1 domain (unknown origin) in presence of 10 uM of ATP
- ChEMBL_2317876 Inhibition of JAK3 JH1 domain (unknown origin) in presence of 10 uM of ATP
- ChEMBL_2317877 Inhibition of TYK2 JH1 domain (unknown origin) in presence of 10 uM of ATP
- ChEMBL_2317883 Inhibition of TYK2 JH2 domain (unknown origin) in presence of 10 uM of ATP
- ChEBML_155549 Inhibition of fraction II of guinea pig phosphodiesterase
- ChEBML_208949 Inhibition of Thymidylate synthase of Escherichia coli (Ki)
- ChEBML_31924 Inhibition of crude aldose reductase of rat lens
- ChEMBL_156175 (CHEMBL760944) Inhibition of phosphodiesterase 1 of bovine heart
- ChEMBL_211317 (CHEMBL818977) Inhibition of polymerization of purified bovine tubulin
- ChEMBL_2224166 (CHEMBL5137679) Inhibition of phosphorylation of eIF4E (unknown origin)
- ChEMBL_2284276 Inhibition of LIMK1 (unknown origin) phosphorylation of cofilin
- ChEMBL_2427091 Inhibition of human mTOR in presence of ATP
- ChEMBL_2502299 Inhibition of human JNK1 in presence of ATP
- ChEMBL_2502300 Inhibition of human JNK2 in presence of ATP
- ChEMBL_2502301 Inhibition of human JNK3 in presence of ATP
- ChEMBL_2526023 Inhibition of human recombinant intracellular domain of erbB2
- ChEMBL_2526024 Inhibition of human recombinant intracellular domain of EGFR
- ChEMBL_2543595 Inhibition of human RSK2 in presence of ATP
- ChEMBL_2543596 Inhibition of human CHK2 in presence of ATP
- ChEMBL_2543597 Inhibition of human FLT3 in presence of ATP
- ChEMBL_2543598 Inhibition of human RSK1 in presence of ATP
- ChEMBL_2543599 Inhibition of human PKCtheta in presence of ATP
- ChEMBL_2543600 Inhibition of human YES1 in presence of ATP
- ChEMBL_2543601 Inhibition of human FYN in presence of ATP
- ChEMBL_2543605 Inhibition of human SRC in presence of ATP
- ChEMBL_2543606 Inhibition of human TRKa in presence of ATP
- ChEMBL_2543607 Inhibition of human PKCbeta1 in presence of ATP
- ChEMBL_2543608 Inhibition of human PKCmu in presence of ATP
- ChEMBL_2543609 Inhibition of human PRKG1 in presence of ATP
- ChEMBL_2543611 Inhibition of human PRK1 in presence of ATP
- ChEMBL_2543612 Inhibition of human FGR in presence of ATP
- ChEMBL_2543613 Inhibition of human PKCgamma in presence of ATP
- ChEMBL_2559768 Inhibition of human OPRK1 in presence of GTPgS
- ChEMBL_2559769 Inhibition of human OPRM1 in presence of GTPgS
- ChEMBL_27816 (CHEMBL636706) Inhibition of Acetylcholinesterase activity of calf forebrain
- ChEMBL_28904 (CHEMBL638603) Inhibition of acetylcholinesterase (AChE) of human erythrocytes
- ChEMBL_305479 (CHEMBL830270) Inhibition of Mammalian target of Rapamycin mTOR
- ChEMBL_330335 (CHEMBL869970) Inhibition of isomerase activity of Cyclophilin A
- ChEMBL_359170 (CHEMBL869329) Inhibition of trypsin like activity of proteasome
- ChEMBL_359171 (CHEMBL869330) Inhibition of chymotrypsin like activity of proteasome
- ChEMBL_361112 (CHEMBL859178) Inhibition of FabG in presence of NADPH
- ChEMBL_361956 (CHEMBL859179) Inhibition of SRC in presence of ATP
- ChEMBL_453798 (CHEMBL885799) Inhibition of diphenolase activity of mushroom tyrosinase
- ChEMBL_473707 (CHEMBL936806) Inhibition of Chk1 mediated phosphorylation of cdc25C
- ChEMBL_52852 (CHEMBL664376) Inhibition of Dihydrofolate reductase of Pneumocystis carinii
- ChEMBL_52972 (CHEMBL664180) Inhibition of Dihydrofolate Reductase of Pneumocystis carinii.
- ChEMBL_53329 (CHEMBL664915) Inhibition of Dihydrofolate reductase of Toxoplasma gondii
- ChEMBL_53335 (CHEMBL664921) Inhibition of Dihydrofolate Reductase of Toxoplasma gondii.
- ChEMBL_537410 (CHEMBL992600) Inhibition of polymerase activity of HIV1 RT
- ChEMBL_546026 (CHEMBL1034201) Inhibition of Cdc7-mediated phosphorylation of Mcm2
- ChEMBL_54972 (CHEMBL666701) Inhibition of Dihydrofolate Reductase of Rat Liver.
- ChEMBL_55132 (CHEMBL668777) Inhibition of Dihydrofolate reductase of rat liver
- ChEMBL_582224 (CHEMBL1059884) Inhibition of diphenolase activity of mushroom tyrosinase
- ChEMBL_589608 (CHEMBL1052161) Inhibition of ligase activity of human MDM2
- ChEMBL_644134 (CHEMBL1212033) Inhibition of GTPase activity of Dynamin 1
- ChEMBL_646200 (CHEMBL1216341) Inhibition of calcineurin phosphatase activity of CyPA
- ChEMBL_673771 (CHEMBL1274948) Inhibition of CYP3A4 in presence of NADPH
- ChEMBL_835444 (CHEMBL2072150) Inhibition of core catalytic domain of PDE3A
- ChEMBL_835445 (CHEMBL2072151) Inhibition of core catalytic domain of PDE4B
- ChEMBL_140005 (CHEMBL748724) Inhibition of binding of [3H]L-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of neostriatum region of forebrain
- ChEMBL_140007 (CHEMBL872731) Inhibition of binding of [3H]l-quinuclidinyl benzilate ([3H]L-QNB) to muscarinic acetylcholine receptor of periaqueductal region of midbrain
- ChEMBL_140018 (CHEMBL748651) Inhibition of binding of [3H]L-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of subiculum region of forebrain
- ChEMBL_2127676 (CHEMBL4837021) Inhibition of eIF4A (unknown origin) assessed as inhibition of translation of RNA featuring highly structured 5'-UTR of c-Myc
- Biological Activity Assay The DLK dissociation constants (Kd) have been determined in the KINOMEscan KdELECT Service at DiscoveRx. A fusion protein of full length of human DLK (amino acids 1-859) and the DNA binding domain of NFkB was expressed in transiently transfected HEK293 cells. From these HEK 293 cells, extracts were prepared in M-PER extraction buffer (Pierce) in the presence of Protease Inhibitor Cocktail Complete (Roche) and Phosphatase Inhibitor Cocktail Set II (Merck) per manufacturers' instructions. The DLK fusion protein was labeled with a chimeric double-stranded DNA tag containing the NFkB binding site (5′-GGGAATTCCC-3′) fused to an amplicon for qPCR readout, which was added directly to the expression extract (the final concentration of DNA-tag in the binding reaction is 0.1 nM).
- ChEBML_212702 In vitro evaluation of inhibition of cleavage of the chromogenic substrate by human enzyme trypsin
- ChEBML_70432 Inhibition of rate of incorporation of [3H]FPP into recombinant Ras-CVIM by human farnesyltransferase.
- ChEMBL_142630 (CHEMBL746898) Inhibition of binding of [3H]- nisoxatine to Norepinephrine transporter (NET) of rat cerebral cortex.
- ChEMBL_1521038 (CHEMBL3624469) Inhibition of EGFR (unknown origin) by HTRF assay in presence of Km of ATP
- ChEMBL_1615834 (CHEMBL3857903) Inhibition of serotonin transporter (unknown origin) assessed as suppression of synaptosomal uptake of serotonin
- ChEMBL_1615835 (CHEMBL3857904) Inhibition of norepinephrine transporter (unknown origin) assessed as suppression of synaptosomal uptake of norepinephrine
- ChEMBL_1615836 (CHEMBL3857905) Inhibition of dopamine transporter (unknown origin) assessed as suppression of synaptosomal uptake of dopamine
- ChEMBL_1877683 (CHEMBL4379077) Inhibition of human LIMK2 in presence of 10 uM of ATP by radiometric analysis
- ChEMBL_198044 (CHEMBL800741) Inhibition of binding of [3H]- citalopram to Serotonin transporter (SERT) of rat cerebral cortex.
- ChEMBL_215035 (CHEMBL820885) Tested for inhibition of vasopressin-stimulated adenylate cyclase of medullary membranes of pig kidney.
- ChEMBL_399838 (CHEMBL910317) Inhibition of non-phosphorylated form of rabbit muscle glycogen phosphorylase in presence of phosphate
- ChEMBL_492346 (CHEMBL948342) Inhibition of recombinant TK1-mediated phosphorylation of [CH3-3H]deoxythymidine in presence of dithiothreitol
- ChEMBL_90893 (CHEMBL701793) Inhibitory concentration of compound against disintegration (reversal of strand transfer)of HIV-1 integrase
- ChEMBL_90894 (CHEMBL701794) Inhibitory concentration of compound against disintegration (reversal of strand transfer)of HIV-1 integrase
- ChEMBL_953434 (CHEMBL2350788) Inhibition of recombinant human PTP1B assessed as inhibition of hydrolysis of pNPP by spectrophotometry
- Inhibition Assay Inhibition of CODH by Diphenyliodomium chloride. Inactivation of the FAD cofactor of CODH was accomplished by covalent modification of the flavin with diphenyliodonium chloride using a modification of the procedure of Chakraborty and Massey.
- Ecto-5'-Nucleotidase Inhibition Assay The enzymatic assay of both human and rat ecto-5'-nucleotidase were performed with slight modifications in the previously described method. The stock solution of compounds were prepared with concentration of 10mM in 10% DMSO and their activity were determined by diluting them further in assay buffer (1 mM CaCl2, 2 mM MgCl2 and 10 mM Tris HCl (pH 7.4) to 1mM concentration. The final assay volume 100 μL contained 70 μL of assay buffer (2 mM MgCl2, 1 mM CaCl2 and 10 mM Tris HCl, pH 7.4), 10 μL of compound and 10 μL of human e5'NT (6.94 μg/mL) protein extract or rat e5'NT (7.17 μg/mL). Then the reaction mixture was incubated for 10 min at 37 °C. Afterwards, 10 μL of AMP substrate was added to initiate the reaction. The reaction was stopped by providing temperature of 99 °C for 20 min. Aliquots of 50 μL of each reaction mixture was transferred into CE mini vial and hydrodynamically injected into the capillary by using pressure of 0.5 psi for 5s. The electrosmatic separation of substrate and product peaks occurred by applying voltage of 15 kV. The concentration of product i.e. adenosine was estimated by calculating the area under its absorbance peak at 260 nm.
- ChEMBL_139860 (CHEMBL746357) Inhibition of binding of [3H]l-quinuclidinyl benzilate ([3H]L-QNB) to muscarinic acetylcholine receptor of ventral subiculum region of forebrain
- ChEMBL_139876 (CHEMBL744317) Inhibition of binding of [3H]l-quinuclidinyl benzilate ([3H]L-QNB) to muscarinic acetylcholine receptor of cudate nucleus region of forebrain
- ChEMBL_139991 (CHEMBL747171) Inhibition of binding of [3H]l-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of hippocampus CA4 region of forebrain
- ChEMBL_139995 (CHEMBL747175) Inhibition of binding of [3H]L-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of inferior coliculus region of hindbrain
- ChEMBL_140008 (CHEMBL748726) Inhibition of binding of [3H]l-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of pontine nuclei region of hindbrain
- ChEMBL_140012 (CHEMBL748645) Inhibition of binding of [3H]L-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of raphe pontis region of hindbrain
- ChEMBL_140020 (CHEMBL748653) Inhibition of binding of [3H]L-quinuclidinyl benzilate ([3H]-l-QNB) to muscarinic acetylcholine receptor of superior coliculus region of midbrain